Incidental Mutation 'R1298:Zbtb25'
ID158223
Institutional Source Beutler Lab
Gene Symbol Zbtb25
Ensembl Gene ENSMUSG00000056459
Gene Namezinc finger and BTB domain containing 25
SynonymsKup, Zfp-50, Zfp50, 2810462M08Rik, 2900064P18Rik
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76347782-76369602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76350001 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 149 (E149G)
Ref Sequence ENSEMBL: ENSMUSP00000134748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167011] [ENSMUST00000176102] [ENSMUST00000176187] [ENSMUST00000176278] [ENSMUST00000176509] [ENSMUST00000176967]
Predicted Effect probably benign
Transcript: ENSMUST00000167011
AA Change: E149G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000128471
Gene: ENSMUSG00000056459
AA Change: E149G

DomainStartEndE-ValueType
BTB 24 119 4.59e-15 SMART
low complexity region 213 224 N/A INTRINSIC
ZnF_C2H2 239 261 4.4e-2 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176102
AA Change: E149G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135853
Gene: ENSMUSG00000056459
AA Change: E149G

DomainStartEndE-ValueType
BTB 24 119 4.59e-15 SMART
low complexity region 213 224 N/A INTRINSIC
ZnF_C2H2 239 261 4.4e-2 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176187
SMART Domains Protein: ENSMUSP00000135458
Gene: ENSMUSG00000056459

DomainStartEndE-ValueType
BTB 24 119 4.59e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176278
AA Change: E149G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134748
Gene: ENSMUSG00000056459
AA Change: E149G

DomainStartEndE-ValueType
BTB 24 119 4.59e-15 SMART
low complexity region 213 224 N/A INTRINSIC
ZnF_C2H2 239 261 4.4e-2 SMART
ZnF_C2H2 353 375 3.63e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176509
SMART Domains Protein: ENSMUSP00000135817
Gene: ENSMUSG00000056459

DomainStartEndE-ValueType
Pfam:BTB 14 65 1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176967
SMART Domains Protein: ENSMUSP00000135434
Gene: ENSMUSG00000056459

DomainStartEndE-ValueType
BTB 24 99 1.06e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220077
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Zbtb25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02321:Zbtb25 APN 12 76350133 missense probably damaging 0.99
IGL02993:Zbtb25 APN 12 76349417 missense probably damaging 1.00
R1851:Zbtb25 UTSW 12 76349714 missense probably damaging 1.00
R1918:Zbtb25 UTSW 12 76349301 nonsense probably null
R2108:Zbtb25 UTSW 12 76350106 missense probably benign 0.29
R2209:Zbtb25 UTSW 12 76349129 makesense probably null
R5400:Zbtb25 UTSW 12 76349702 nonsense probably null
R5579:Zbtb25 UTSW 12 76349164 missense possibly damaging 0.94
R7570:Zbtb25 UTSW 12 76369592 unclassified probably benign
R8086:Zbtb25 UTSW 12 76349149 missense probably benign 0.27
U24488:Zbtb25 UTSW 12 76349240 missense probably benign 0.05
Z1176:Zbtb25 UTSW 12 76349365 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACATCTCTCCTGCTTGATGGACAC -3'
(R):5'- GGTTGGACACACAAAGCCTTGTTG -3'

Sequencing Primer
(F):5'- CTTGATGGACACTGGGGGC -3'
(R):5'- GTTTCATCAAGGCAGATTGCCAG -3'
Posted On2014-02-18