Incidental Mutation 'R1298:Jag2'
ID158225
Institutional Source Beutler Lab
Gene Symbol Jag2
Ensembl Gene ENSMUSG00000002799
Gene Namejagged 2
SynonymsSerh, D12Ggc2e
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112907819-112929776 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 112916319 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000075827]
Predicted Effect probably benign
Transcript: ENSMUST00000075827
SMART Domains Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MNNL 26 105 4.2e-31 PFAM
low complexity region 108 123 N/A INTRINSIC
DSL 178 240 1.48e-36 SMART
EGF_like 244 274 7.23e1 SMART
EGF 275 305 4.56e0 SMART
EGF_CA 307 345 8.5e-9 SMART
EGF 350 383 4e-5 SMART
EGF_CA 385 421 5.39e-11 SMART
EGF_CA 423 459 3.51e-10 SMART
EGF_CA 461 496 1.01e-10 SMART
EGF_CA 498 534 1.17e-6 SMART
EGF_CA 536 572 6.35e-8 SMART
EGF 588 634 7.53e-1 SMART
EGF_CA 636 672 2.89e-11 SMART
EGF 677 710 3.68e-4 SMART
EGF 715 748 1.32e-5 SMART
EGF 754 787 1.34e-6 SMART
EGF_CA 789 825 2.58e-8 SMART
EGF_CA 827 863 7.23e-12 SMART
VWC 872 949 1.3e-1 SMART
low complexity region 1002 1035 N/A INTRINSIC
transmembrane domain 1085 1107 N/A INTRINSIC
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1170 1199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221696
Predicted Effect probably benign
Transcript: ENSMUST00000223140
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Jag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Jag2 APN 12 112912718 missense probably benign 0.20
IGL00954:Jag2 APN 12 112920406 missense possibly damaging 0.50
IGL01532:Jag2 APN 12 112914363 missense probably damaging 0.98
IGL01646:Jag2 APN 12 112916349 missense possibly damaging 0.65
IGL02243:Jag2 APN 12 112916345 missense possibly damaging 0.94
IGL02447:Jag2 APN 12 112912612 missense probably damaging 1.00
IGL02458:Jag2 APN 12 112915993 missense probably damaging 0.98
IGL02516:Jag2 APN 12 112910566 missense probably damaging 1.00
IGL02574:Jag2 APN 12 112915511 missense probably benign 0.32
IGL02629:Jag2 APN 12 112914514 splice site probably benign
IGL02873:Jag2 APN 12 112910502 missense probably benign 0.00
IGL03087:Jag2 APN 12 112913948 missense possibly damaging 0.60
Jaguarundi UTSW 12 112915469 critical splice donor site probably null
R0068:Jag2 UTSW 12 112915193 splice site probably benign
R0310:Jag2 UTSW 12 112913377 unclassified probably benign
R0963:Jag2 UTSW 12 112915314 missense probably damaging 1.00
R1188:Jag2 UTSW 12 112920121 nonsense probably null
R1256:Jag2 UTSW 12 112914419 missense possibly damaging 0.50
R1317:Jag2 UTSW 12 112914501 missense probably benign
R2079:Jag2 UTSW 12 112920377 missense probably damaging 1.00
R2345:Jag2 UTSW 12 112909064 missense probably damaging 1.00
R4654:Jag2 UTSW 12 112913646 missense probably benign 0.13
R4782:Jag2 UTSW 12 112914249 missense probably benign
R4798:Jag2 UTSW 12 112916632 missense probably benign 0.01
R5242:Jag2 UTSW 12 112916866 missense probably damaging 0.97
R5350:Jag2 UTSW 12 112908922 missense possibly damaging 0.77
R5364:Jag2 UTSW 12 112910534 missense probably damaging 1.00
R6129:Jag2 UTSW 12 112920349 nonsense probably null
R6362:Jag2 UTSW 12 112920122 missense probably damaging 0.97
R6376:Jag2 UTSW 12 112909329 missense probably benign 0.00
R6819:Jag2 UTSW 12 112910541 missense probably damaging 1.00
R6844:Jag2 UTSW 12 112916714 missense probably damaging 1.00
R6968:Jag2 UTSW 12 112914258 missense probably benign 0.10
R7514:Jag2 UTSW 12 112929052 missense probably benign 0.19
R7663:Jag2 UTSW 12 112913666 missense probably damaging 1.00
R7730:Jag2 UTSW 12 112922041 missense probably damaging 1.00
R7754:Jag2 UTSW 12 112915469 critical splice donor site probably null
R7828:Jag2 UTSW 12 112913180 missense probably benign 0.19
R7874:Jag2 UTSW 12 112915946 missense probably damaging 0.99
R8075:Jag2 UTSW 12 112915274 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAGTGAGTAGGGACACAGTACACG -3'
(R):5'- TACCTGCATCAATGCTGAGCCTGAC -3'

Sequencing Primer
(F):5'- GACACAGTACACGGGGTC -3'
(R):5'- GCTACTTGGGCAAGAACTGC -3'
Posted On2014-02-18