Mutagenetix > Incidental Mutation

Incidental Mutation 'R1298:Jag2'

158225

Institutional Source

Beutler Lab

Gene Symbol

Jag2

Ensembl Gene

ENSMUSG00000002799

Gene Name

jagged 2

Synonyms

Serh, D12Ggc2e

MMRRC Submission

039364-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1298 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112907819-112929776 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to T at 112916319 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075827]

AlphaFold

Q9QYE5

Predicted Effect

probably benign
Transcript: ENSMUST00000075827

SMART Domains

Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:MNNL	26	105	4.2e-31	PFAM
low complexity region	108	123	N/A	INTRINSIC
DSL	178	240	1.48e-36	SMART
EGF_like	244	274	7.23e1	SMART
EGF	275	305	4.56e0	SMART
EGF_CA	307	345	8.5e-9	SMART
EGF	350	383	4e-5	SMART
EGF_CA	385	421	5.39e-11	SMART
EGF_CA	423	459	3.51e-10	SMART
EGF_CA	461	496	1.01e-10	SMART
EGF_CA	498	534	1.17e-6	SMART
EGF_CA	536	572	6.35e-8	SMART
EGF	588	634	7.53e-1	SMART
EGF_CA	636	672	2.89e-11	SMART
EGF	677	710	3.68e-4	SMART
EGF	715	748	1.32e-5	SMART
EGF	754	787	1.34e-6	SMART
EGF_CA	789	825	2.58e-8	SMART
EGF_CA	827	863	7.23e-12	SMART
VWC	872	949	1.3e-1	SMART
low complexity region	1002	1035	N/A	INTRINSIC
transmembrane domain	1085	1107	N/A	INTRINSIC
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1170	1199	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184711

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220771

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220855

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221320

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221696

Predicted Effect

probably benign
Transcript: ENSMUST00000223140

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.1%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox5	A	G	6: 116,427,264	W145R	probably damaging	Het
Aspm	T	A	1: 139,457,419	V267D	probably benign	Het
Bbs4	A	T	9: 59,339,813	W135R	probably damaging	Het
Cavin4	T	C	4: 48,672,593	V346A	probably benign	Het
Cdk18	A	C	1: 132,122,451		probably benign	Het
Cyp2j11	C	T	4: 96,307,260		probably null	Het
Dnah6	A	T	6: 73,159,135	I1007K	probably damaging	Het
Dnmt1	T	C	9: 20,941,456	E118G	probably benign	Het
Eef2	C	CN	10: 81,178,768		probably null	Het
Gm14496	T	C	2: 181,996,092	F320L	probably benign	Het
Gm2046	T	A	12: 87,980,083	D98E	probably benign	Het
Gsdmc3	A	T	15: 63,860,281	L299M	probably damaging	Het
H6pd	T	C	4: 149,982,514	I472V	probably benign	Het
Hao2	G	T	3: 98,883,669	T63K	possibly damaging	Het
Mapre3	A	G	5: 30,864,867	Y211C	probably damaging	Het
Mycbp2	A	G	14: 103,155,898	S2966P	probably damaging	Het
Nsd3	T	A	8: 25,679,936	V696E	possibly damaging	Het
Obscn	A	G	11: 59,054,897	Y4163H	possibly damaging	Het
Olfr1120	G	A	2: 87,358,070	A209T	probably benign	Het
Olfr747	A	T	14: 50,680,880	Y251*	probably null	Het
Olfr788	G	T	10: 129,473,064	C124F	probably damaging	Het
Pde2a	A	G	7: 101,507,202	E607G	probably benign	Het
Pinlyp	T	A	7: 24,544,966	D51V	probably damaging	Het
Rcbtb2	T	A	14: 73,162,388	I87N	probably damaging	Het
Sfswap	A	G	5: 129,541,378	I459V	probably benign	Het
Slitrk6	T	C	14: 110,751,865	N137D	possibly damaging	Het
Smg1	A	T	7: 118,168,211		probably benign	Het
Sobp	T	A	10: 43,022,335	H418L	probably damaging	Het
Spock1	A	C	13: 57,512,750	D180E	probably benign	Het
Upk3a	G	A	15: 85,020,551	V167I	probably benign	Het
Vmn1r180	T	C	7: 23,953,147	V245A	possibly damaging	Het
Zbtb25	T	C	12: 76,350,001	E149G	probably benign	Het
Zgrf1	T	C	3: 127,583,889	C44R	possibly damaging	Het

Other mutations in Jag2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Jag2	APN	12	112912718	missense	probably benign	0.20
IGL00954:Jag2	APN	12	112920406	missense	possibly damaging	0.50
IGL01532:Jag2	APN	12	112914363	missense	probably damaging	0.98
IGL01646:Jag2	APN	12	112916349	missense	possibly damaging	0.65
IGL02243:Jag2	APN	12	112916345	missense	possibly damaging	0.94
IGL02447:Jag2	APN	12	112912612	missense	probably damaging	1.00
IGL02458:Jag2	APN	12	112915993	missense	probably damaging	0.98
IGL02516:Jag2	APN	12	112910566	missense	probably damaging	1.00
IGL02574:Jag2	APN	12	112915511	missense	probably benign	0.32
IGL02629:Jag2	APN	12	112914514	splice site	probably benign
IGL02873:Jag2	APN	12	112910502	missense	probably benign	0.00
IGL03087:Jag2	APN	12	112913948	missense	possibly damaging	0.60
Jaguarundi	UTSW	12	112915469	critical splice donor site	probably null
R0068:Jag2	UTSW	12	112915193	splice site	probably benign
R0310:Jag2	UTSW	12	112913377	unclassified	probably benign
R0963:Jag2	UTSW	12	112915314	missense	probably damaging	1.00
R1188:Jag2	UTSW	12	112920121	nonsense	probably null
R1256:Jag2	UTSW	12	112914419	missense	possibly damaging	0.50
R1317:Jag2	UTSW	12	112914501	missense	probably benign
R2079:Jag2	UTSW	12	112920377	missense	probably damaging	1.00
R2345:Jag2	UTSW	12	112909064	missense	probably damaging	1.00
R4654:Jag2	UTSW	12	112913646	missense	probably benign	0.13
R4782:Jag2	UTSW	12	112914249	missense	probably benign
R4798:Jag2	UTSW	12	112916632	missense	probably benign	0.01
R5242:Jag2	UTSW	12	112916866	missense	probably damaging	0.97
R5350:Jag2	UTSW	12	112908922	missense	possibly damaging	0.77
R5364:Jag2	UTSW	12	112910534	missense	probably damaging	1.00
R6129:Jag2	UTSW	12	112920349	nonsense	probably null
R6362:Jag2	UTSW	12	112920122	missense	probably damaging	0.97
R6376:Jag2	UTSW	12	112909329	missense	probably benign	0.00
R6819:Jag2	UTSW	12	112910541	missense	probably damaging	1.00
R6844:Jag2	UTSW	12	112916714	missense	probably damaging	1.00
R6968:Jag2	UTSW	12	112914258	missense	probably benign	0.10
R7514:Jag2	UTSW	12	112929052	missense	probably benign	0.19
R7663:Jag2	UTSW	12	112913666	missense	probably damaging	1.00
R7730:Jag2	UTSW	12	112922041	missense	probably damaging	1.00
R7754:Jag2	UTSW	12	112915469	critical splice donor site	probably null
R7828:Jag2	UTSW	12	112913180	missense	probably benign	0.19
R7874:Jag2	UTSW	12	112915946	missense	probably damaging	0.99
R8075:Jag2	UTSW	12	112915274	missense	probably benign	0.05
R8845:Jag2	UTSW	12	112920094	missense	probably damaging	1.00
R8876:Jag2	UTSW	12	112909637	missense	probably benign	0.00
R9117:Jag2	UTSW	12	112913659	nonsense	probably null
R9400:Jag2	UTSW	12	112911988	nonsense	probably null
R9673:Jag2	UTSW	12	112911796	nonsense	probably null
R9688:Jag2	UTSW	12	112908944	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- TCAGTGAGTAGGGACACAGTACACG -3'
(R):5'- TACCTGCATCAATGCTGAGCCTGAC -3'

Sequencing Primer
(F):5'- GACACAGTACACGGGGTC -3'
(R):5'- GCTACTTGGGCAAGAACTGC -3'

Posted On

2014-02-18