Incidental Mutation 'R1298:Rcbtb2'
ID158228
Institutional Source Beutler Lab
Gene Symbol Rcbtb2
Ensembl Gene ENSMUSG00000022106
Gene Nameregulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2
SynonymsRc/btb2, Chc1l, 2610028E02Rik, 2810420M18Rik
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location73123037-73207843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73162388 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 87 (I87N)
Ref Sequence ENSEMBL: ENSMUSP00000130732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022702] [ENSMUST00000110952] [ENSMUST00000163339] [ENSMUST00000163533] [ENSMUST00000163797] [ENSMUST00000164298] [ENSMUST00000164822] [ENSMUST00000165429] [ENSMUST00000165567] [ENSMUST00000165727] [ENSMUST00000167021] [ENSMUST00000169479] [ENSMUST00000171767] [ENSMUST00000170370] [ENSMUST00000170677] [ENSMUST00000169513] [ENSMUST00000170368] [ENSMUST00000167401] [ENSMUST00000171070]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022702
AA Change: I87N

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022702
Gene: ENSMUSG00000022106
AA Change: I87N

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110952
AA Change: I87N

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106577
Gene: ENSMUSG00000022106
AA Change: I87N

DomainStartEndE-ValueType
Pfam:RCC1 117 167 3e-16 PFAM
Pfam:RCC1_2 154 183 7.8e-15 PFAM
Pfam:RCC1 170 220 1.4e-15 PFAM
Pfam:RCC1 223 272 9.4e-18 PFAM
Pfam:RCC1_2 259 288 2.6e-11 PFAM
Pfam:RCC1 275 324 1.2e-13 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163339
Predicted Effect probably damaging
Transcript: ENSMUST00000163533
AA Change: I87N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130828
Gene: ENSMUSG00000022106
AA Change: I87N

DomainStartEndE-ValueType
Pfam:RCC1 117 150 4.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163797
AA Change: I73N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132125
Gene: ENSMUSG00000022106
AA Change: I73N

DomainStartEndE-ValueType
Pfam:RCC1 136 174 7.7e-12 PFAM
low complexity region 199 207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164298
AA Change: I73N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126651
Gene: ENSMUSG00000022106
AA Change: I73N

DomainStartEndE-ValueType
Pfam:RCC1 103 153 2.9e-17 PFAM
Pfam:RCC1_2 140 169 2.2e-15 PFAM
Pfam:RCC1 156 206 4.4e-15 PFAM
Pfam:RCC1 209 247 1.2e-11 PFAM
low complexity region 272 280 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164822
AA Change: I87N

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131588
Gene: ENSMUSG00000022106
AA Change: I87N

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165429
AA Change: I63N

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127258
Gene: ENSMUSG00000022106
AA Change: I63N

DomainStartEndE-ValueType
Pfam:RCC1 93 143 4.4e-17 PFAM
Pfam:RCC1_2 130 157 5.2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165567
AA Change: I87N

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130240
Gene: ENSMUSG00000022106
AA Change: I87N

DomainStartEndE-ValueType
Pfam:RCC1 117 167 5.3e-17 PFAM
Pfam:RCC1_2 154 172 6.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165727
SMART Domains Protein: ENSMUSP00000128479
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 11 60 2.3e-14 PFAM
Pfam:RCC1 63 90 6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167021
Predicted Effect possibly damaging
Transcript: ENSMUST00000169479
AA Change: I87N

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126898
Gene: ENSMUSG00000022106
AA Change: I87N

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.1e-16 PFAM
Pfam:RCC1_2 154 183 7.1e-15 PFAM
Pfam:RCC1 170 220 1.7e-14 PFAM
Pfam:RCC1 223 272 7.1e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-12 PFAM
Pfam:RCC1 275 324 8e-16 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171767
AA Change: I87N

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127397
Gene: ENSMUSG00000022106
AA Change: I87N

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.7e-16 PFAM
Pfam:RCC1_2 154 183 4.9e-15 PFAM
Pfam:RCC1 170 220 8.4e-16 PFAM
Pfam:RCC1 223 272 5.5e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-11 PFAM
Pfam:RCC1 275 324 6.8e-14 PFAM
BTB 394 487 2.69e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170370
AA Change: I87N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130732
Gene: ENSMUSG00000022106
AA Change: I87N

DomainStartEndE-ValueType
SCOP:d1a12a_ 45 128 1e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170677
AA Change: I63N

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126510
Gene: ENSMUSG00000022106
AA Change: I63N

DomainStartEndE-ValueType
Pfam:RCC1 93 143 3.1e-16 PFAM
Pfam:RCC1_2 130 159 1.9e-14 PFAM
Pfam:RCC1 146 196 4.7e-14 PFAM
Pfam:RCC1 199 248 1.9e-17 PFAM
Pfam:RCC1_2 235 264 4.4e-12 PFAM
Pfam:RCC1 251 300 2.2e-15 PFAM
BTB 370 463 2.69e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169513
AA Change: I63N

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128579
Gene: ENSMUSG00000022106
AA Change: I63N

DomainStartEndE-ValueType
Pfam:RCC1 93 143 3.1e-16 PFAM
Pfam:RCC1_2 130 159 1.9e-14 PFAM
Pfam:RCC1 146 196 4.7e-14 PFAM
Pfam:RCC1 199 248 1.9e-17 PFAM
Pfam:RCC1_2 235 264 4.4e-12 PFAM
Pfam:RCC1 251 300 2.2e-15 PFAM
BTB 370 463 2.69e-21 SMART
Predicted Effect silent
Transcript: ENSMUST00000170368
SMART Domains Protein: ENSMUSP00000126276
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
SCOP:d1a12a_ 45 86 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171163
Predicted Effect probably benign
Transcript: ENSMUST00000167401
Predicted Effect probably benign
Transcript: ENSMUST00000171070
Meta Mutation Damage Score 0.3334 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two C-terminal BTB/POZ domains that is related to regulator of chromosome condensation (RCC). The encoded protein may act as a guanine nucleotide exchange factor. This gene is observed to be lost or underexpressed in prostate cancers. There is a pseudogene of this gene on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Upk3a G A 15: 85,020,551 V167I probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Rcbtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Rcbtb2 APN 14 73164782 missense possibly damaging 0.94
IGL02550:Rcbtb2 APN 14 73162019 missense probably damaging 1.00
IGL02800:Rcbtb2 APN 14 73168103 nonsense probably null
IGL02811:Rcbtb2 APN 14 73174411 missense probably damaging 1.00
R0319:Rcbtb2 UTSW 14 73178469 missense probably benign 0.04
R0390:Rcbtb2 UTSW 14 73178547 missense probably damaging 0.96
R0448:Rcbtb2 UTSW 14 73178429 splice site probably benign
R1567:Rcbtb2 UTSW 14 73162462 missense probably benign 0.07
R2014:Rcbtb2 UTSW 14 73174386 splice site probably benign
R2137:Rcbtb2 UTSW 14 73162051 missense probably damaging 1.00
R2218:Rcbtb2 UTSW 14 73178565 critical splice donor site probably null
R4505:Rcbtb2 UTSW 14 73173905 missense probably damaging 1.00
R5832:Rcbtb2 UTSW 14 73166822 missense possibly damaging 0.95
R5898:Rcbtb2 UTSW 14 73161965 nonsense probably null
R6484:Rcbtb2 UTSW 14 73177050 missense probably damaging 0.99
R7252:Rcbtb2 UTSW 14 73166780 missense probably damaging 1.00
R7606:Rcbtb2 UTSW 14 73182366 intron probably null
R7654:Rcbtb2 UTSW 14 73174501 missense probably benign 0.00
R7762:Rcbtb2 UTSW 14 73178466 missense probably benign
R7951:Rcbtb2 UTSW 14 73166552 nonsense probably null
R7960:Rcbtb2 UTSW 14 73161944 missense probably benign 0.01
R8086:Rcbtb2 UTSW 14 73173865 missense probably damaging 1.00
R8366:Rcbtb2 UTSW 14 73207192 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGTACAGGCTACCCTGTCATCG -3'
(R):5'- AGCCAGCCACTCTTGCTCAATC -3'

Sequencing Primer
(F):5'- ACCCTGTCATCGTTGAAGATGTTAG -3'
(R):5'- CTTGCTCAATCAGAGAGTTTGC -3'
Posted On2014-02-18