Mutagenetix > Incidental Mutation

Incidental Mutation 'R1298:Slitrk6'

158230

Institutional Source

Beutler Lab

Gene Symbol

Slitrk6

Ensembl Gene

ENSMUSG00000045871

Gene Name

SLIT and NTRK-like family, member 6

Synonyms

4832410J21Rik

MMRRC Submission

039364-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R1298 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110748580-110755149 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110751865 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 137 (N137D)

Ref Sequence

ENSEMBL: ENSMUSP00000077492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078386]

AlphaFold

Q8C110

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078386
AA Change: N137D

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: N137D

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:LRRNT	30	68	4e-15	BLAST
LRR	87	110	1.71e1	SMART
LRR	111	134	3.07e-1	SMART
LRR	135	158	4.44e0	SMART
LRR_TYP	159	182	2.09e-3	SMART
LRR	185	206	6.23e1	SMART
LRRCT	218	268	5.61e-5	SMART
low complexity region	287	301	N/A	INTRINSIC
Blast:LRRNT	327	364	2e-17	BLAST
LRR	388	408	2.68e1	SMART
LRR_TYP	409	432	3.63e-3	SMART
LRR_TYP	433	456	6.23e-2	SMART
LRR_TYP	457	480	3.69e-4	SMART
low complexity region	501	513	N/A	INTRINSIC
LRRCT	516	566	1.53e-6	SMART
transmembrane domain	610	632	N/A	INTRINSIC
low complexity region	634	642	N/A	INTRINSIC

Meta Mutation Damage Score

0.1419

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 94.1%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alox5	A	G	6: 116,427,264	W145R	probably damaging	Het
Aspm	T	A	1: 139,457,419	V267D	probably benign	Het
Bbs4	A	T	9: 59,339,813	W135R	probably damaging	Het
Cavin4	T	C	4: 48,672,593	V346A	probably benign	Het
Cdk18	A	C	1: 132,122,451		probably benign	Het
Cyp2j11	C	T	4: 96,307,260		probably null	Het
Dnah6	A	T	6: 73,159,135	I1007K	probably damaging	Het
Dnmt1	T	C	9: 20,941,456	E118G	probably benign	Het
Eef2	C	CN	10: 81,178,768		probably null	Het
Gm14496	T	C	2: 181,996,092	F320L	probably benign	Het
Gm2046	T	A	12: 87,980,083	D98E	probably benign	Het
Gsdmc3	A	T	15: 63,860,281	L299M	probably damaging	Het
H6pd	T	C	4: 149,982,514	I472V	probably benign	Het
Hao2	G	T	3: 98,883,669	T63K	possibly damaging	Het
Jag2	C	T	12: 112,916,319		probably benign	Het
Mapre3	A	G	5: 30,864,867	Y211C	probably damaging	Het
Mycbp2	A	G	14: 103,155,898	S2966P	probably damaging	Het
Nsd3	T	A	8: 25,679,936	V696E	possibly damaging	Het
Obscn	A	G	11: 59,054,897	Y4163H	possibly damaging	Het
Olfr1120	G	A	2: 87,358,070	A209T	probably benign	Het
Olfr747	A	T	14: 50,680,880	Y251*	probably null	Het
Olfr788	G	T	10: 129,473,064	C124F	probably damaging	Het
Pde2a	A	G	7: 101,507,202	E607G	probably benign	Het
Pinlyp	T	A	7: 24,544,966	D51V	probably damaging	Het
Rcbtb2	T	A	14: 73,162,388	I87N	probably damaging	Het
Sfswap	A	G	5: 129,541,378	I459V	probably benign	Het
Smg1	A	T	7: 118,168,211		probably benign	Het
Sobp	T	A	10: 43,022,335	H418L	probably damaging	Het
Spock1	A	C	13: 57,512,750	D180E	probably benign	Het
Upk3a	G	A	15: 85,020,551	V167I	probably benign	Het
Vmn1r180	T	C	7: 23,953,147	V245A	possibly damaging	Het
Zbtb25	T	C	12: 76,350,001	E149G	probably benign	Het
Zgrf1	T	C	3: 127,583,889	C44R	possibly damaging	Het

Other mutations in Slitrk6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Slitrk6	APN	14	110751115	missense	probably benign	0.35
IGL01131:Slitrk6	APN	14	110751576	missense	probably damaging	1.00
IGL01294:Slitrk6	APN	14	110750074	missense	probably benign
IGL01295:Slitrk6	APN	14	110751436	missense	possibly damaging	0.50
IGL01762:Slitrk6	APN	14	110751624	missense	probably damaging	1.00
IGL02165:Slitrk6	APN	14	110751817	missense	probably benign	0.41
IGL02546:Slitrk6	APN	14	110749794	missense	probably benign	0.18
IGL03103:Slitrk6	APN	14	110749941	missense	probably benign
PIT1430001:Slitrk6	UTSW	14	110750427	missense	possibly damaging	0.93
PIT4480001:Slitrk6	UTSW	14	110749825	frame shift	probably null
R0035:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0066:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0067:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0069:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0107:Slitrk6	UTSW	14	110751963	missense	possibly damaging	0.69
R0157:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0422:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0422:Slitrk6	UTSW	14	110752293	start gained	probably benign
R0454:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0505:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0633:Slitrk6	UTSW	14	110751885	missense	probably damaging	1.00
R0711:Slitrk6	UTSW	14	110749819	missense	probably damaging	1.00
R0843:Slitrk6	UTSW	14	110750098	missense	probably benign
R1693:Slitrk6	UTSW	14	110750928	missense	probably damaging	1.00
R1756:Slitrk6	UTSW	14	110750552	missense	probably benign
R1998:Slitrk6	UTSW	14	110751823	missense	probably damaging	0.99
R2049:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2140:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2142:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2314:Slitrk6	UTSW	14	110751955	missense	probably damaging	1.00
R2566:Slitrk6	UTSW	14	110750272	missense	probably benign	0.00
R4231:Slitrk6	UTSW	14	110751388	missense	probably benign	0.02
R4236:Slitrk6	UTSW	14	110750148	missense	probably benign	0.07
R4247:Slitrk6	UTSW	14	110750739	missense	probably damaging	1.00
R4576:Slitrk6	UTSW	14	110750170	missense	probably benign	0.05
R4856:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4858:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4859:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4860:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4860:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4886:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4931:Slitrk6	UTSW	14	110750379	missense	probably damaging	1.00
R5255:Slitrk6	UTSW	14	110749753	makesense	probably null
R5281:Slitrk6	UTSW	14	110750373	missense	probably damaging	1.00
R5450:Slitrk6	UTSW	14	110750097	missense	probably benign
R5579:Slitrk6	UTSW	14	110751217	missense	possibly damaging	0.82
R5689:Slitrk6	UTSW	14	110752126	missense	probably benign
R5935:Slitrk6	UTSW	14	110749873	missense	probably benign	0.00
R6016:Slitrk6	UTSW	14	110750526	missense	probably benign	0.00
R6312:Slitrk6	UTSW	14	110750247	missense	probably benign	0.00
R6890:Slitrk6	UTSW	14	110751096	nonsense	probably null
R6952:Slitrk6	UTSW	14	110750542	missense	probably benign
R7378:Slitrk6	UTSW	14	110749863	missense	probably damaging	1.00
R8354:Slitrk6	UTSW	14	110752046	missense	probably damaging	1.00
R8401:Slitrk6	UTSW	14	110752021	missense	possibly damaging	0.67
R8454:Slitrk6	UTSW	14	110752046	missense	probably damaging	1.00
R8807:Slitrk6	UTSW	14	110750691	missense	possibly damaging	0.77
R8814:Slitrk6	UTSW	14	110749938	missense	probably benign
R8826:Slitrk6	UTSW	14	110751369	missense	probably benign
R9681:Slitrk6	UTSW	14	110750826	missense	probably damaging	1.00
R9740:Slitrk6	UTSW	14	110749998	missense	probably damaging	0.99
R9740:Slitrk6	UTSW	14	110750012	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- AGGCGACTCAGTACACTCCCTTTG -3'
(R):5'- CTTGACAATGCTTCACACGAACGAC -3'

Sequencing Primer
(F):5'- ACACTCCCTTTGAAAGGTGG -3'
(R):5'- CACGAACGACTTTTCTGGAC -3'

Posted On

2014-02-18