Incidental Mutation 'R1298:Upk3a'
ID158232
Institutional Source Beutler Lab
Gene Symbol Upk3a
Ensembl Gene ENSMUSG00000022435
Gene Nameuroplakin 3A
SynonymsUpk3, 1110017C07Rik
MMRRC Submission 039364-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1298 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85017141-85022547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85020551 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 167 (V167I)
Ref Sequence ENSEMBL: ENSMUSP00000023070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023070]
Predicted Effect probably benign
Transcript: ENSMUST00000023070
AA Change: V167I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023070
Gene: ENSMUSG00000022435
AA Change: V167I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230801
Meta Mutation Damage Score 0.1141 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the uroplakin family, a group of transmembrane proteins that form complexes on the apical surface of the bladder epithelium. Mutations in this gene may be associated with renal adysplasia. Alternatively spliced transcript variants have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous null mice exhibit urogenital defects including abnormal urothelium, vesicoureteral reflux, and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox5 A G 6: 116,427,264 W145R probably damaging Het
Aspm T A 1: 139,457,419 V267D probably benign Het
Bbs4 A T 9: 59,339,813 W135R probably damaging Het
Cavin4 T C 4: 48,672,593 V346A probably benign Het
Cdk18 A C 1: 132,122,451 probably benign Het
Cyp2j11 C T 4: 96,307,260 probably null Het
Dnah6 A T 6: 73,159,135 I1007K probably damaging Het
Dnmt1 T C 9: 20,941,456 E118G probably benign Het
Eef2 C CN 10: 81,178,768 probably null Het
Gm14496 T C 2: 181,996,092 F320L probably benign Het
Gm2046 T A 12: 87,980,083 D98E probably benign Het
Gsdmc3 A T 15: 63,860,281 L299M probably damaging Het
H6pd T C 4: 149,982,514 I472V probably benign Het
Hao2 G T 3: 98,883,669 T63K possibly damaging Het
Jag2 C T 12: 112,916,319 probably benign Het
Mapre3 A G 5: 30,864,867 Y211C probably damaging Het
Mycbp2 A G 14: 103,155,898 S2966P probably damaging Het
Nsd3 T A 8: 25,679,936 V696E possibly damaging Het
Obscn A G 11: 59,054,897 Y4163H possibly damaging Het
Olfr1120 G A 2: 87,358,070 A209T probably benign Het
Olfr747 A T 14: 50,680,880 Y251* probably null Het
Olfr788 G T 10: 129,473,064 C124F probably damaging Het
Pde2a A G 7: 101,507,202 E607G probably benign Het
Pinlyp T A 7: 24,544,966 D51V probably damaging Het
Rcbtb2 T A 14: 73,162,388 I87N probably damaging Het
Sfswap A G 5: 129,541,378 I459V probably benign Het
Slitrk6 T C 14: 110,751,865 N137D possibly damaging Het
Smg1 A T 7: 118,168,211 probably benign Het
Sobp T A 10: 43,022,335 H418L probably damaging Het
Spock1 A C 13: 57,512,750 D180E probably benign Het
Vmn1r180 T C 7: 23,953,147 V245A possibly damaging Het
Zbtb25 T C 12: 76,350,001 E149G probably benign Het
Zgrf1 T C 3: 127,583,889 C44R possibly damaging Het
Other mutations in Upk3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Upk3a APN 15 85019585 missense probably damaging 1.00
R1791:Upk3a UTSW 15 85020614 missense possibly damaging 0.91
R2092:Upk3a UTSW 15 85018085 missense probably damaging 0.98
R2924:Upk3a UTSW 15 85018149 missense probably benign 0.17
R2925:Upk3a UTSW 15 85018149 missense probably benign 0.17
R3402:Upk3a UTSW 15 85018183 critical splice donor site probably null
R3403:Upk3a UTSW 15 85018183 critical splice donor site probably null
R4574:Upk3a UTSW 15 85020551 missense possibly damaging 0.95
R4896:Upk3a UTSW 15 85019423 missense probably benign 0.00
R5893:Upk3a UTSW 15 85019337 missense probably damaging 1.00
R6239:Upk3a UTSW 15 85021314 missense probably damaging 1.00
R7403:Upk3a UTSW 15 85019508 missense possibly damaging 0.91
R7486:Upk3a UTSW 15 85018024 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTCCCAGAGCAGATGCTACCAGAC -3'
(R):5'- AACAGTGAGCAAGTGACCTGTGAC -3'

Sequencing Primer
(F):5'- TGCTACCAGACTGGAAAAGG -3'
(R):5'- GCTGGTACTCTCAAGTCTAAGCAG -3'
Posted On2014-02-18