Incidental Mutation 'R1299:Cdc73'
ID158233
Institutional Source Beutler Lab
Gene Symbol Cdc73
Ensembl Gene ENSMUSG00000026361
Gene Namecell division cycle 73, Paf1/RNA polymerase II complex component
SynonymsHrpt2, 8430414L16Rik, C130030P16Rik
MMRRC Submission 039365-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1299 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location143598800-143702893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143699281 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 58 (D58G)
Ref Sequence ENSEMBL: ENSMUSP00000018337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018337] [ENSMUST00000159794]
Predicted Effect probably benign
Transcript: ENSMUST00000018337
AA Change: D58G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000018337
Gene: ENSMUSG00000026361
AA Change: D58G

DomainStartEndE-ValueType
Pfam:CDC73_N 1 297 3.4e-135 PFAM
Pfam:CDC73_C 356 521 2.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159794
SMART Domains Protein: ENSMUSP00000139872
Gene: ENSMUSG00000026361

DomainStartEndE-ValueType
low complexity region 36 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212510
Meta Mutation Damage Score 0.1084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone methyltransferase complex. This protein appears to facilitate the association of 3' mRNA processing factors with actively-transcribed chromatin. Mutations in this gene have been linked to hyperparathyroidism-jaw tumor syndrome, familial isolated hyperparathyroidism, and parathyroid carcinoma. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality around hatching or implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,821 L2228P possibly damaging Het
Acnat1 T A 4: 49,450,925 E62V possibly damaging Het
Adam7 A G 14: 68,526,299 probably benign Het
Ate1 A T 7: 130,504,755 V292D probably damaging Het
Cbx8 T C 11: 119,040,850 M1V probably null Het
Cgnl1 G A 9: 71,721,712 probably benign Het
Col27a1 G A 4: 63,265,631 probably benign Het
D430042O09Rik A C 7: 125,852,023 M1109L probably benign Het
Fam133b T C 5: 3,554,626 probably benign Het
Fndc3a A G 14: 72,566,198 probably benign Het
Golga3 G A 5: 110,204,843 A867T probably benign Het
Gpr142 A T 11: 114,804,359 Y50F probably benign Het
Gramd1c A G 16: 43,983,502 probably benign Het
Gypa G A 8: 80,496,753 V53I unknown Het
H2-DMb2 T C 17: 34,150,587 V235A probably benign Het
Igkv10-94 T C 6: 68,704,498 probably benign Het
Klhl17 T C 4: 156,230,962 Y484C probably damaging Het
Ltbp3 T C 19: 5,745,428 probably benign Het
Mapkbp1 G A 2: 120,015,404 C412Y probably damaging Het
Mblac2 C A 13: 81,711,726 C65* probably null Het
Olfr1457 T A 19: 13,095,130 N173Y possibly damaging Het
Olfr815 A G 10: 129,902,077 I211T probably benign Het
Parn G A 16: 13,664,729 T85M probably benign Het
Pcdhb22 T C 18: 37,520,590 S704P probably damaging Het
Prex1 A G 2: 166,585,907 F942L possibly damaging Het
Prox1 G T 1: 190,146,943 probably benign Het
Prss55 A T 14: 64,081,698 I70N probably damaging Het
Slc25a13 C T 6: 6,113,937 probably null Het
Smarca2 T C 19: 26,771,611 probably null Het
Smarcc2 C A 10: 128,461,378 N46K probably damaging Het
Tdpoz4 A T 3: 93,796,462 Y22F probably benign Het
Tgfbr1 T A 4: 47,396,587 probably null Het
Xpr1 A C 1: 155,417,203 I11S probably damaging Het
Zfp354b A C 11: 50,923,470 S209R probably benign Het
Zfp882 A G 8: 71,913,473 E88G probably damaging Het
Other mutations in Cdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Cdc73 APN 1 143671332 missense probably benign 0.10
IGL01598:Cdc73 APN 1 143699279 missense probably damaging 1.00
R0648:Cdc73 UTSW 1 143695462 missense probably benign 0.00
R1342:Cdc73 UTSW 1 143702492 critical splice donor site probably null
R1411:Cdc73 UTSW 1 143609514 splice site probably benign
R1837:Cdc73 UTSW 1 143667657 missense possibly damaging 0.46
R2208:Cdc73 UTSW 1 143609382 missense probably damaging 1.00
R3721:Cdc73 UTSW 1 143695453 missense possibly damaging 0.77
R3797:Cdc73 UTSW 1 143677723 missense probably benign 0.22
R4088:Cdc73 UTSW 1 143608514 utr 3 prime probably benign
R4603:Cdc73 UTSW 1 143677857 critical splice acceptor site probably null
R4782:Cdc73 UTSW 1 143627875 missense probably benign 0.10
R4799:Cdc73 UTSW 1 143627875 missense probably benign 0.10
R5512:Cdc73 UTSW 1 143702616 missense probably damaging 1.00
R5801:Cdc73 UTSW 1 143608543 missense probably benign 0.01
R6006:Cdc73 UTSW 1 143617439 missense probably damaging 1.00
R6258:Cdc73 UTSW 1 143691473 missense probably benign 0.32
R6260:Cdc73 UTSW 1 143691473 missense probably benign 0.32
R6744:Cdc73 UTSW 1 143702149 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCCATGACAACTTCAGACATCTGAAACC -3'
(R):5'- GCGTCCCTAGTAAAACCTTCATCTGAGT -3'

Sequencing Primer
(F):5'- TCTGAAACCCATAGGTGAAGTC -3'
(R):5'- TACATGTAACTAAGGCC -3'
Posted On2014-02-18