Incidental Mutation 'R1299:Tdpoz4'
ID158238
Institutional Source Beutler Lab
Gene Symbol Tdpoz4
Ensembl Gene ENSMUSG00000060256
Gene NameTD and POZ domain containing 4
Synonyms
MMRRC Submission 039365-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.782) question?
Stock #R1299 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location93796398-93797510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93796462 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 22 (Y22F)
Ref Sequence ENSEMBL: ENSMUSP00000075338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075953]
Predicted Effect probably benign
Transcript: ENSMUST00000075953
AA Change: Y22F

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075338
Gene: ENSMUSG00000060256
AA Change: Y22F

DomainStartEndE-ValueType
MATH 24 130 4.81e-2 SMART
BTB 188 287 2.9e-26 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,821 L2228P possibly damaging Het
Acnat1 T A 4: 49,450,925 E62V possibly damaging Het
Adam7 A G 14: 68,526,299 probably benign Het
Ate1 A T 7: 130,504,755 V292D probably damaging Het
Cbx8 T C 11: 119,040,850 M1V probably null Het
Cdc73 T C 1: 143,699,281 D58G probably benign Het
Cgnl1 G A 9: 71,721,712 probably benign Het
Col27a1 G A 4: 63,265,631 probably benign Het
D430042O09Rik A C 7: 125,852,023 M1109L probably benign Het
Fam133b T C 5: 3,554,626 probably benign Het
Fndc3a A G 14: 72,566,198 probably benign Het
Golga3 G A 5: 110,204,843 A867T probably benign Het
Gpr142 A T 11: 114,804,359 Y50F probably benign Het
Gramd1c A G 16: 43,983,502 probably benign Het
Gypa G A 8: 80,496,753 V53I unknown Het
H2-DMb2 T C 17: 34,150,587 V235A probably benign Het
Igkv10-94 T C 6: 68,704,498 probably benign Het
Klhl17 T C 4: 156,230,962 Y484C probably damaging Het
Ltbp3 T C 19: 5,745,428 probably benign Het
Mapkbp1 G A 2: 120,015,404 C412Y probably damaging Het
Mblac2 C A 13: 81,711,726 C65* probably null Het
Olfr1457 T A 19: 13,095,130 N173Y possibly damaging Het
Olfr815 A G 10: 129,902,077 I211T probably benign Het
Parn G A 16: 13,664,729 T85M probably benign Het
Pcdhb22 T C 18: 37,520,590 S704P probably damaging Het
Prex1 A G 2: 166,585,907 F942L possibly damaging Het
Prox1 G T 1: 190,146,943 probably benign Het
Prss55 A T 14: 64,081,698 I70N probably damaging Het
Slc25a13 C T 6: 6,113,937 probably null Het
Smarca2 T C 19: 26,771,611 probably null Het
Smarcc2 C A 10: 128,461,378 N46K probably damaging Het
Tgfbr1 T A 4: 47,396,587 probably null Het
Xpr1 A C 1: 155,417,203 I11S probably damaging Het
Zfp354b A C 11: 50,923,470 S209R probably benign Het
Zfp882 A G 8: 71,913,473 E88G probably damaging Het
Other mutations in Tdpoz4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Tdpoz4 APN 3 93797073 missense probably benign 0.22
IGL01731:Tdpoz4 APN 3 93796882 missense possibly damaging 0.62
IGL01934:Tdpoz4 APN 3 93797472 missense probably damaging 1.00
IGL03269:Tdpoz4 APN 3 93796837 missense probably damaging 1.00
FR4340:Tdpoz4 UTSW 3 93796880 frame shift probably null
FR4342:Tdpoz4 UTSW 3 93796880 frame shift probably null
R0387:Tdpoz4 UTSW 3 93796700 missense probably benign 0.26
R1134:Tdpoz4 UTSW 3 93797218 missense probably benign 0.42
R1574:Tdpoz4 UTSW 3 93796528 missense probably benign 0.16
R1574:Tdpoz4 UTSW 3 93796528 missense probably benign 0.16
R2113:Tdpoz4 UTSW 3 93797044 missense probably damaging 1.00
R4601:Tdpoz4 UTSW 3 93797032 missense probably damaging 1.00
R4738:Tdpoz4 UTSW 3 93797089 missense probably damaging 1.00
R4948:Tdpoz4 UTSW 3 93797011 missense probably damaging 1.00
R5495:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5519:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5550:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5595:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5596:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R5615:Tdpoz4 UTSW 3 93797499 missense probably benign 0.07
R7198:Tdpoz4 UTSW 3 93797355 missense probably benign 0.16
R7290:Tdpoz4 UTSW 3 93796848 missense not run
R7677:Tdpoz4 UTSW 3 93797508 makesense probably null
X0066:Tdpoz4 UTSW 3 93796968 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGCCCTTAAACAGCCATGTAGAGT -3'
(R):5'- TGCCCAAACTGAGCCCTTTTCAC -3'

Sequencing Primer
(F):5'- tgagtagggatgagaagagagg -3'
(R):5'- CCCGGTTGGGTATACTCTCAAA -3'
Posted On2014-02-18