Incidental Mutation 'R1299:Gpr142'
ID158256
Institutional Source Beutler Lab
Gene Symbol Gpr142
Ensembl Gene ENSMUSG00000034677
Gene NameG protein-coupled receptor 142
Synonyms
MMRRC Submission 039365-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1299 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location114798924-114806745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114804359 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 50 (Y50F)
Ref Sequence ENSEMBL: ENSMUSP00000102194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045319] [ENSMUST00000106584]
Predicted Effect probably benign
Transcript: ENSMUST00000045319
AA Change: Y50F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000045029
Gene: ENSMUSG00000034677
AA Change: Y50F

DomainStartEndE-ValueType
Pfam:7tm_1 84 321 4.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106584
AA Change: Y50F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102194
Gene: ENSMUSG00000034677
AA Change: Y50F

DomainStartEndE-ValueType
Pfam:7tm_1 86 327 2.7e-14 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GPR142 is a member of the rhodopsin family of G protein-coupled receptors (GPRs) (Fredriksson et al., 2003 [PubMed 14623098]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,821 L2228P possibly damaging Het
Acnat1 T A 4: 49,450,925 E62V possibly damaging Het
Adam7 A G 14: 68,526,299 probably benign Het
Ate1 A T 7: 130,504,755 V292D probably damaging Het
Cbx8 T C 11: 119,040,850 M1V probably null Het
Cdc73 T C 1: 143,699,281 D58G probably benign Het
Cgnl1 G A 9: 71,721,712 probably benign Het
Col27a1 G A 4: 63,265,631 probably benign Het
D430042O09Rik A C 7: 125,852,023 M1109L probably benign Het
Fam133b T C 5: 3,554,626 probably benign Het
Fndc3a A G 14: 72,566,198 probably benign Het
Golga3 G A 5: 110,204,843 A867T probably benign Het
Gramd1c A G 16: 43,983,502 probably benign Het
Gypa G A 8: 80,496,753 V53I unknown Het
H2-DMb2 T C 17: 34,150,587 V235A probably benign Het
Igkv10-94 T C 6: 68,704,498 probably benign Het
Klhl17 T C 4: 156,230,962 Y484C probably damaging Het
Ltbp3 T C 19: 5,745,428 probably benign Het
Mapkbp1 G A 2: 120,015,404 C412Y probably damaging Het
Mblac2 C A 13: 81,711,726 C65* probably null Het
Olfr1457 T A 19: 13,095,130 N173Y possibly damaging Het
Olfr815 A G 10: 129,902,077 I211T probably benign Het
Parn G A 16: 13,664,729 T85M probably benign Het
Pcdhb22 T C 18: 37,520,590 S704P probably damaging Het
Prex1 A G 2: 166,585,907 F942L possibly damaging Het
Prox1 G T 1: 190,146,943 probably benign Het
Prss55 A T 14: 64,081,698 I70N probably damaging Het
Slc25a13 C T 6: 6,113,937 probably null Het
Smarca2 T C 19: 26,771,611 probably null Het
Smarcc2 C A 10: 128,461,378 N46K probably damaging Het
Tdpoz4 A T 3: 93,796,462 Y22F probably benign Het
Tgfbr1 T A 4: 47,396,587 probably null Het
Xpr1 A C 1: 155,417,203 I11S probably damaging Het
Zfp354b A C 11: 50,923,470 S209R probably benign Het
Zfp882 A G 8: 71,913,473 E88G probably damaging Het
Other mutations in Gpr142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Gpr142 APN 11 114804326 missense probably damaging 0.99
IGL02325:Gpr142 APN 11 114806121 missense probably damaging 1.00
R0054:Gpr142 UTSW 11 114798929 missense probably benign
R0054:Gpr142 UTSW 11 114798929 missense probably benign
R0403:Gpr142 UTSW 11 114806029 missense probably damaging 0.99
R0433:Gpr142 UTSW 11 114805997 missense probably damaging 1.00
R5022:Gpr142 UTSW 11 114804388 missense probably benign 0.17
R5113:Gpr142 UTSW 11 114804317 missense probably benign 0.21
R5261:Gpr142 UTSW 11 114804342 missense probably damaging 0.97
R5895:Gpr142 UTSW 11 114798959 nonsense probably null
R6041:Gpr142 UTSW 11 114806377 missense probably damaging 1.00
R7679:Gpr142 UTSW 11 114806707 missense possibly damaging 0.48
R8062:Gpr142 UTSW 11 114806531 missense probably benign 0.05
X0017:Gpr142 UTSW 11 114805918 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGAGTTGTCGCCACTACCAATG -3'
(R):5'- ATAGCCCTAATTCTGGCTCAGCCTG -3'

Sequencing Primer
(F):5'- TCCCATAGAGTTAGGGACTGC -3'
(R):5'- TGAGGTCCCCACTCACCAG -3'
Posted On2014-02-18