Incidental Mutation 'R1299:Mblac2'
ID158258
Institutional Source Beutler Lab
Gene Symbol Mblac2
Ensembl Gene ENSMUSG00000051098
Gene Namemetallo-beta-lactamase domain containing 2
Synonyms
MMRRC Submission 039365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1299 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location81711341-81753275 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 81711726 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 65 (C65*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048993] [ENSMUST00000057598] [ENSMUST00000161920]
Predicted Effect probably benign
Transcript: ENSMUST00000048993
SMART Domains Protein: ENSMUSP00000035289
Gene: ENSMUSG00000035834

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 223 7e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000057598
AA Change: C66*
SMART Domains Protein: ENSMUSP00000051644
Gene: ENSMUSG00000051098
AA Change: C66*

DomainStartEndE-ValueType
Lactamase_B 29 231 4.92e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161093
SMART Domains Protein: ENSMUSP00000124885
Gene: ENSMUSG00000035834

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 83 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161920
SMART Domains Protein: ENSMUSP00000125054
Gene: ENSMUSG00000035834

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 105 1e-13 PFAM
transmembrane domain 136 158 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224299
AA Change: C65*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,294,821 L2228P possibly damaging Het
Acnat1 T A 4: 49,450,925 E62V possibly damaging Het
Adam7 A G 14: 68,526,299 probably benign Het
Ate1 A T 7: 130,504,755 V292D probably damaging Het
Cbx8 T C 11: 119,040,850 M1V probably null Het
Cdc73 T C 1: 143,699,281 D58G probably benign Het
Cgnl1 G A 9: 71,721,712 probably benign Het
Col27a1 G A 4: 63,265,631 probably benign Het
D430042O09Rik A C 7: 125,852,023 M1109L probably benign Het
Fam133b T C 5: 3,554,626 probably benign Het
Fndc3a A G 14: 72,566,198 probably benign Het
Golga3 G A 5: 110,204,843 A867T probably benign Het
Gpr142 A T 11: 114,804,359 Y50F probably benign Het
Gramd1c A G 16: 43,983,502 probably benign Het
Gypa G A 8: 80,496,753 V53I unknown Het
H2-DMb2 T C 17: 34,150,587 V235A probably benign Het
Igkv10-94 T C 6: 68,704,498 probably benign Het
Klhl17 T C 4: 156,230,962 Y484C probably damaging Het
Ltbp3 T C 19: 5,745,428 probably benign Het
Mapkbp1 G A 2: 120,015,404 C412Y probably damaging Het
Olfr1457 T A 19: 13,095,130 N173Y possibly damaging Het
Olfr815 A G 10: 129,902,077 I211T probably benign Het
Parn G A 16: 13,664,729 T85M probably benign Het
Pcdhb22 T C 18: 37,520,590 S704P probably damaging Het
Prex1 A G 2: 166,585,907 F942L possibly damaging Het
Prox1 G T 1: 190,146,943 probably benign Het
Prss55 A T 14: 64,081,698 I70N probably damaging Het
Slc25a13 C T 6: 6,113,937 probably null Het
Smarca2 T C 19: 26,771,611 probably null Het
Smarcc2 C A 10: 128,461,378 N46K probably damaging Het
Tdpoz4 A T 3: 93,796,462 Y22F probably benign Het
Tgfbr1 T A 4: 47,396,587 probably null Het
Xpr1 A C 1: 155,417,203 I11S probably damaging Het
Zfp354b A C 11: 50,923,470 S209R probably benign Het
Zfp882 A G 8: 71,913,473 E88G probably damaging Het
Other mutations in Mblac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Mblac2 APN 13 81750006 missense probably damaging 1.00
IGL01377:Mblac2 APN 13 81750147 missense probably damaging 1.00
IGL01767:Mblac2 APN 13 81750315 missense probably damaging 1.00
R2006:Mblac2 UTSW 13 81711741 missense probably benign
R2435:Mblac2 UTSW 13 81750249 missense probably damaging 0.99
R4031:Mblac2 UTSW 13 81750089 missense possibly damaging 0.59
R4804:Mblac2 UTSW 13 81750309 nonsense probably null
R4865:Mblac2 UTSW 13 81711976 nonsense probably null
R4906:Mblac2 UTSW 13 81711587 missense probably null
R5480:Mblac2 UTSW 13 81750276 missense possibly damaging 0.77
R7760:Mblac2 UTSW 13 81711877 missense probably benign 0.00
R8138:Mblac2 UTSW 13 81711650 missense probably damaging 1.00
Z1177:Mblac2 UTSW 13 81750167 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCTCTGGGCGATGGCATCTTC -3'
(R):5'- TGTAACATGCTGTACACGCTCTCC -3'

Sequencing Primer
(F):5'- AAGAACGGTTCTACGAGTCAGG -3'
(R):5'- ACTGCCTGCACTCGGAAC -3'
Posted On2014-02-18