Incidental Mutation 'R1300:Eif2ak4'
ID158274
Institutional Source Beutler Lab
Gene Symbol Eif2ak4
Ensembl Gene ENSMUSG00000005102
Gene Nameeukaryotic translation initiation factor 2 alpha kinase 4
SynonymsGCN2
MMRRC Submission 039366-MU
Accession Numbers

MGI: 1353427

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1300 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118388618-118475234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118463983 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1125 (V1125A)
Ref Sequence ENSEMBL: ENSMUSP00000106494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005233] [ENSMUST00000102527] [ENSMUST00000110870] [ENSMUST00000110872] [ENSMUST00000110874]
Predicted Effect probably benign
Transcript: ENSMUST00000005233
AA Change: V1403A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000005233
Gene: ENSMUSG00000005102
AA Change: V1403A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RWD 25 137 3.42e-38 SMART
coiled coil region 146 205 N/A INTRINSIC
Pfam:Pkinase 323 538 4.6e-27 PFAM
Pfam:Pkinase_Tyr 326 535 5.5e-18 PFAM
Pfam:Pkinase 589 663 1.7e-11 PFAM
Pfam:Pkinase_Tyr 589 663 1.2e-5 PFAM
low complexity region 728 738 N/A INTRINSIC
Pfam:Pkinase 781 1000 2.6e-38 PFAM
Pfam:Pkinase_Tyr 786 998 1.8e-18 PFAM
Pfam:tRNA-synt_His 1054 1380 5.7e-18 PFAM
Pfam:HGTP_anticodon2 1392 1647 5.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102527
AA Change: V1291A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099586
Gene: ENSMUSG00000005102
AA Change: V1291A

DomainStartEndE-ValueType
coiled coil region 34 93 N/A INTRINSIC
Pfam:Pkinase 211 426 1.6e-22 PFAM
Pfam:Pkinase_Tyr 215 423 6.8e-18 PFAM
Pfam:Pkinase_Tyr 477 551 1.2e-5 PFAM
Pfam:Pkinase 477 552 3.9e-11 PFAM
low complexity region 616 626 N/A INTRINSIC
Pfam:Pkinase 647 888 9.4e-42 PFAM
Pfam:Pkinase_Tyr 672 886 1.4e-19 PFAM
Pfam:tRNA-synt_His 941 1268 4.8e-19 PFAM
Pfam:HGTP_anticodon2 1280 1535 1e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110870
AA Change: V1125A

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106494
Gene: ENSMUSG00000005102
AA Change: V1125A

DomainStartEndE-ValueType
Pfam:Pkinase 45 260 3.3e-22 PFAM
Pfam:Pkinase_Tyr 47 257 1.3e-17 PFAM
Pfam:Pkinase_Tyr 311 385 2.5e-5 PFAM
Pfam:Pkinase 311 386 8e-11 PFAM
low complexity region 450 460 N/A INTRINSIC
Pfam:Pkinase 481 722 1.9e-41 PFAM
Pfam:Pkinase_Tyr 506 720 2.8e-19 PFAM
Pfam:tRNA-synt_His 775 1102 8.7e-19 PFAM
Pfam:HGTP_anticodon2 1114 1369 1.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110872
AA Change: V1282A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106496
Gene: ENSMUSG00000005102
AA Change: V1282A

DomainStartEndE-ValueType
coiled coil region 25 84 N/A INTRINSIC
Pfam:Pkinase 202 417 3.8e-22 PFAM
Pfam:Pkinase_Tyr 206 414 1.6e-17 PFAM
Pfam:Pkinase_Tyr 468 542 2.8e-5 PFAM
Pfam:Pkinase 468 543 9.1e-11 PFAM
low complexity region 607 617 N/A INTRINSIC
Pfam:Pkinase 638 879 2.2e-41 PFAM
Pfam:Pkinase_Tyr 663 877 3.3e-19 PFAM
Pfam:tRNA-synt_His 932 1259 1.1e-18 PFAM
Pfam:HGTP_anticodon2 1271 1526 2.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110874
AA Change: V1325A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106498
Gene: ENSMUSG00000005102
AA Change: V1325A

DomainStartEndE-ValueType
Pfam:RWD 8 56 6.4e-8 PFAM
coiled coil region 68 127 N/A INTRINSIC
Pfam:Pkinase 245 460 1.1e-22 PFAM
Pfam:Pkinase_Tyr 247 457 4.2e-18 PFAM
Pfam:Pkinase_Tyr 511 585 7.8e-6 PFAM
Pfam:Pkinase 511 586 2.5e-11 PFAM
low complexity region 650 660 N/A INTRINSIC
Pfam:Pkinase 681 922 6.2e-42 PFAM
Pfam:Pkinase_Tyr 706 920 9.3e-20 PFAM
Pfam:tRNA-synt_His 975 1302 3.8e-19 PFAM
Pfam:HGTP_anticodon2 1314 1569 5.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125281
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of kinases that phosphorylate the alpha subunit of eukaryotic translation initiation factor-2 (EIF2), resulting in the downregulaton of protein synthesis. The encoded protein responds to amino acid deprivation by binding uncharged transfer RNAs. It may also be activated by glucose deprivation and viral infection. Mutations in this gene have been found in individuals suffering from autosomal recessive pulmonary venoocclusive-disease-2. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a null allele have altered feeding behavior, synaptic plasticity and dendritic cell function. Homozygotes for another null allele show enhanced muscle loss and morbidity after amino acid deprivation. Homozygotes for an ENU-induced allele show higher susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(3) Gene trapped(4) Chemically induced(1)
 

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,244,808 I2535T probably damaging Het
Ank3 A G 10: 70,004,665 I952V probably benign Het
Ankar A C 1: 72,643,164 V1414G probably benign Het
Arl2 A G 19: 6,141,073 M10T probably benign Het
Arpp21 A G 9: 112,143,374 I352T probably damaging Het
BC067074 T C 13: 113,366,160 F133S probably damaging Het
Cacna1e T A 1: 154,398,673 H2162L probably benign Het
Cep170b A C 12: 112,737,257 M622L probably benign Het
Cped1 T C 6: 22,119,553 V337A probably benign Het
Cpn2 T A 16: 30,259,663 T407S probably benign Het
Cpne4 T C 9: 104,993,134 W263R probably damaging Het
Crtc1 A G 8: 70,387,539 probably null Het
Dennd5a A T 7: 109,919,407 I485N probably benign Het
Dnah6 T C 6: 73,124,709 Q1892R probably benign Het
Dse G A 10: 34,152,415 A893V probably benign Het
Dsg1a T G 18: 20,332,149 S466A probably benign Het
Dstyk T C 1: 132,449,913 V419A probably benign Het
Ep400 C A 5: 110,673,560 G2576C probably damaging Het
Eps15l1 A T 8: 72,391,902 D162E probably damaging Het
Fstl4 C A 11: 53,068,627 T165N probably benign Het
Gm5346 A T 8: 43,626,844 Y114* probably null Het
Gm6904 A T 14: 59,251,114 V78D probably damaging Het
Gm8674 T C 13: 49,901,722 noncoding transcript Het
Gtsf2 T A 15: 103,444,353 L39F possibly damaging Het
Hck A C 2: 153,134,147 D202A possibly damaging Het
Il12b T A 11: 44,408,076 probably null Het
Irf4 T C 13: 30,757,585 L307P probably damaging Het
Keg1 G A 19: 12,719,004 R184Q probably damaging Het
Kmt2c T C 5: 25,405,454 D218G probably damaging Het
Map1b T C 13: 99,432,521 K1231E unknown Het
Mapkbp1 T C 2: 120,013,655 Y293H probably benign Het
Mfsd8 A T 3: 40,823,898 D310E probably benign Het
Mmp9 A T 2: 164,948,956 D88V probably damaging Het
Muc5ac G T 7: 141,816,929 C2522F possibly damaging Het
Myo1e A T 9: 70,301,783 I110F probably damaging Het
Neu1 A T 17: 34,934,338 Y279F possibly damaging Het
Nhsl1 A G 10: 18,408,461 H50R probably benign Het
Nlrp3 C T 11: 59,555,768 S780F possibly damaging Het
Npc1l1 T G 11: 6,227,859 D517A probably damaging Het
Olfr299 T C 7: 86,465,743 F111L probably benign Het
Olfr30 T C 11: 58,455,841 Y36C probably damaging Het
Olfr392 T C 11: 73,814,246 T279A probably benign Het
Olfr594 G A 7: 103,220,117 R133Q probably benign Het
P3h2 C A 16: 25,997,236 E176* probably null Het
Parp10 C A 15: 76,241,990 D333Y possibly damaging Het
Pcdhb12 C T 18: 37,437,397 A532V possibly damaging Het
Pde2a A T 7: 101,510,404 T818S possibly damaging Het
Phip A T 9: 82,876,747 L1450Q probably benign Het
Pinx1 A G 14: 63,919,410 E262G probably benign Het
Ppargc1a T C 5: 51,548,672 E19G probably damaging Het
Pum1 T C 4: 130,765,961 I921T probably damaging Het
Rgs22 T A 15: 36,101,762 H106L probably benign Het
Slc10a6 T C 5: 103,606,684 D327G probably benign Het
Syt1 A T 10: 108,631,821 V205D possibly damaging Het
Tep1 C T 14: 50,827,055 probably null Het
Thnsl2 T A 6: 71,134,191 Q231L probably damaging Het
Ttc4 T A 4: 106,667,566 H304L probably damaging Het
Unc5c G A 3: 141,828,543 V923M possibly damaging Het
Zfp777 T C 6: 48,025,770 E506G probably benign Het
Other mutations in Eif2ak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Eif2ak4 APN 2 118464055 missense probably damaging 1.00
IGL00806:Eif2ak4 APN 2 118441166 missense probably benign 0.08
IGL01343:Eif2ak4 APN 2 118422089 missense probably benign 0.00
IGL01796:Eif2ak4 APN 2 118446304 missense probably benign 0.10
IGL02263:Eif2ak4 APN 2 118461778 missense probably benign 0.00
IGL02391:Eif2ak4 APN 2 118420791 missense probably benign 0.19
IGL02516:Eif2ak4 APN 2 118436254 missense probably damaging 1.00
IGL02603:Eif2ak4 APN 2 118450326 missense probably damaging 1.00
IGL02731:Eif2ak4 APN 2 118388814 missense probably benign
IGL02928:Eif2ak4 APN 2 118472687 critical splice donor site probably null
IGL02947:Eif2ak4 APN 2 118431033 missense probably benign 0.00
IGL03191:Eif2ak4 APN 2 118422212 missense probably damaging 1.00
IGL03202:Eif2ak4 APN 2 118400620 missense probably damaging 1.00
IGL03235:Eif2ak4 APN 2 118443140 missense probably damaging 1.00
IGL03375:Eif2ak4 APN 2 118422318 missense probably benign 0.08
absurdum UTSW 2 118420810 nonsense probably null
Ad UTSW 2 118436241 missense probably damaging 1.00
atchoum UTSW 2 118400653 splice site probably benign
reductio UTSW 2 118436158 splice site probably null
PIT4520001:Eif2ak4 UTSW 2 118462327 missense probably damaging 1.00
R0023:Eif2ak4 UTSW 2 118462721 missense probably damaging 1.00
R0358:Eif2ak4 UTSW 2 118463929 intron probably null
R0482:Eif2ak4 UTSW 2 118462347 missense probably damaging 1.00
R0505:Eif2ak4 UTSW 2 118431036 missense probably benign 0.01
R0523:Eif2ak4 UTSW 2 118442096 critical splice donor site probably null
R0578:Eif2ak4 UTSW 2 118474991 splice site probably benign
R0615:Eif2ak4 UTSW 2 118436185 missense probably damaging 1.00
R1531:Eif2ak4 UTSW 2 118443210 missense probably damaging 1.00
R1777:Eif2ak4 UTSW 2 118430839 missense probably damaging 0.98
R1866:Eif2ak4 UTSW 2 118472661 missense probably damaging 1.00
R1932:Eif2ak4 UTSW 2 118448486 missense probably damaging 1.00
R1977:Eif2ak4 UTSW 2 118461757 nonsense probably null
R2011:Eif2ak4 UTSW 2 118430947 missense probably damaging 1.00
R2046:Eif2ak4 UTSW 2 118451408 splice site probably benign
R2122:Eif2ak4 UTSW 2 118455793 missense probably damaging 1.00
R2125:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2126:Eif2ak4 UTSW 2 118422123 missense probably benign 0.02
R2193:Eif2ak4 UTSW 2 118422266 missense probably benign 0.12
R2259:Eif2ak4 UTSW 2 118455783 missense probably damaging 0.97
R2513:Eif2ak4 UTSW 2 118426583 missense probably damaging 1.00
R3798:Eif2ak4 UTSW 2 118474083 missense probably damaging 1.00
R3898:Eif2ak4 UTSW 2 118430923 missense probably damaging 1.00
R3900:Eif2ak4 UTSW 2 118475029 missense probably damaging 1.00
R4375:Eif2ak4 UTSW 2 118427924 missense probably damaging 1.00
R4423:Eif2ak4 UTSW 2 118439066 missense probably benign 0.01
R4589:Eif2ak4 UTSW 2 118417338 missense probably damaging 1.00
R4734:Eif2ak4 UTSW 2 118422087 missense probably damaging 1.00
R5173:Eif2ak4 UTSW 2 118408360 missense probably damaging 1.00
R5367:Eif2ak4 UTSW 2 118436158 splice site probably null
R5471:Eif2ak4 UTSW 2 118474132 missense probably benign 0.02
R5528:Eif2ak4 UTSW 2 118427938 missense probably damaging 1.00
R5634:Eif2ak4 UTSW 2 118462311 missense probably damaging 1.00
R5726:Eif2ak4 UTSW 2 118443132 missense probably damaging 1.00
R5756:Eif2ak4 UTSW 2 118462740 missense possibly damaging 0.95
R5779:Eif2ak4 UTSW 2 118412963 missense possibly damaging 0.85
R5807:Eif2ak4 UTSW 2 118388851 missense probably benign
R6045:Eif2ak4 UTSW 2 118388815 nonsense probably null
R6187:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R6193:Eif2ak4 UTSW 2 118400600 start gained probably benign
R6468:Eif2ak4 UTSW 2 118436241 missense probably damaging 1.00
R6555:Eif2ak4 UTSW 2 118427869 missense probably damaging 0.96
R6616:Eif2ak4 UTSW 2 118454845 nonsense probably null
R6737:Eif2ak4 UTSW 2 118462268 frame shift probably null
R6956:Eif2ak4 UTSW 2 118422267 missense probably damaging 0.96
R7075:Eif2ak4 UTSW 2 118420810 nonsense probably null
R7109:Eif2ak4 UTSW 2 118405051 missense probably damaging 1.00
R7228:Eif2ak4 UTSW 2 118457157 missense probably damaging 0.98
R7441:Eif2ak4 UTSW 2 118471896 missense probably benign 0.01
R7555:Eif2ak4 UTSW 2 118417283 missense possibly damaging 0.64
R7567:Eif2ak4 UTSW 2 118450314 missense probably benign
X0061:Eif2ak4 UTSW 2 118468176 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATCTGTACTGTGTGACTGTTCC -3'
(R):5'- AGTAGGGCACCACTGCCAGTAAAC -3'

Sequencing Primer
(F):5'- GTTCCCAATTTCAGGGGCAC -3'
(R):5'- acaaaaagtaagcaaaaccaacag -3'
Posted On2014-02-18