Incidental Mutation 'R1300:Nhsl1'
ID 158309
Institutional Source Beutler Lab
Gene Symbol Nhsl1
Ensembl Gene ENSMUSG00000039835
Gene Name NHS-like 1
Synonyms 5730409E15Rik, D10Bwg0940e, A630035H13Rik
MMRRC Submission 039366-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1300 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 18318985-18533892 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18408461 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 50 (H50R)
Ref Sequence ENSEMBL: ENSMUSP00000040799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037341] [ENSMUST00000207038]
AlphaFold Q8CAF4
Predicted Effect probably benign
Transcript: ENSMUST00000037341
AA Change: H50R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040799
Gene: ENSMUSG00000039835
AA Change: H50R

DomainStartEndE-ValueType
Pfam:NHS 258 906 1.6e-246 PFAM
low complexity region 918 938 N/A INTRINSIC
low complexity region 942 950 N/A INTRINSIC
low complexity region 958 970 N/A INTRINSIC
low complexity region 992 1024 N/A INTRINSIC
low complexity region 1171 1197 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
low complexity region 1442 1460 N/A INTRINSIC
low complexity region 1484 1503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159299
SMART Domains Protein: ENSMUSP00000124629
Gene: ENSMUSG00000039835

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161510
Predicted Effect probably benign
Transcript: ENSMUST00000207038
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,244,808 I2535T probably damaging Het
Ank3 A G 10: 70,004,665 I952V probably benign Het
Ankar A C 1: 72,643,164 V1414G probably benign Het
Arl2 A G 19: 6,141,073 M10T probably benign Het
Arpp21 A G 9: 112,143,374 I352T probably damaging Het
BC067074 T C 13: 113,366,160 F133S probably damaging Het
Cacna1e T A 1: 154,398,673 H2162L probably benign Het
Cep170b A C 12: 112,737,257 M622L probably benign Het
Cped1 T C 6: 22,119,553 V337A probably benign Het
Cpn2 T A 16: 30,259,663 T407S probably benign Het
Cpne4 T C 9: 104,993,134 W263R probably damaging Het
Crtc1 A G 8: 70,387,539 probably null Het
Dennd5a A T 7: 109,919,407 I485N probably benign Het
Dnah6 T C 6: 73,124,709 Q1892R probably benign Het
Dse G A 10: 34,152,415 A893V probably benign Het
Dsg1a T G 18: 20,332,149 S466A probably benign Het
Dstyk T C 1: 132,449,913 V419A probably benign Het
Eif2ak4 T C 2: 118,463,983 V1125A possibly damaging Het
Ep400 C A 5: 110,673,560 G2576C probably damaging Het
Eps15l1 A T 8: 72,391,902 D162E probably damaging Het
Fstl4 C A 11: 53,068,627 T165N probably benign Het
Gm5346 A T 8: 43,626,844 Y114* probably null Het
Gm6904 A T 14: 59,251,114 V78D probably damaging Het
Gm8674 T C 13: 49,901,722 noncoding transcript Het
Gtsf2 T A 15: 103,444,353 L39F possibly damaging Het
Hck A C 2: 153,134,147 D202A possibly damaging Het
Il12b T A 11: 44,408,076 probably null Het
Irf4 T C 13: 30,757,585 L307P probably damaging Het
Keg1 G A 19: 12,719,004 R184Q probably damaging Het
Kmt2c T C 5: 25,405,454 D218G probably damaging Het
Map1b T C 13: 99,432,521 K1231E unknown Het
Mapkbp1 T C 2: 120,013,655 Y293H probably benign Het
Mfsd8 A T 3: 40,823,898 D310E probably benign Het
Mmp9 A T 2: 164,948,956 D88V probably damaging Het
Muc5ac G T 7: 141,816,929 C2522F possibly damaging Het
Myo1e A T 9: 70,301,783 I110F probably damaging Het
Neu1 A T 17: 34,934,338 Y279F possibly damaging Het
Nlrp3 C T 11: 59,555,768 S780F possibly damaging Het
Npc1l1 T G 11: 6,227,859 D517A probably damaging Het
Olfr299 T C 7: 86,465,743 F111L probably benign Het
Olfr30 T C 11: 58,455,841 Y36C probably damaging Het
Olfr392 T C 11: 73,814,246 T279A probably benign Het
Olfr594 G A 7: 103,220,117 R133Q probably benign Het
P3h2 C A 16: 25,997,236 E176* probably null Het
Parp10 C A 15: 76,241,990 D333Y possibly damaging Het
Pcdhb12 C T 18: 37,437,397 A532V possibly damaging Het
Pde2a A T 7: 101,510,404 T818S possibly damaging Het
Phip A T 9: 82,876,747 L1450Q probably benign Het
Pinx1 A G 14: 63,919,410 E262G probably benign Het
Ppargc1a T C 5: 51,548,672 E19G probably damaging Het
Pum1 T C 4: 130,765,961 I921T probably damaging Het
Rgs22 T A 15: 36,101,762 H106L probably benign Het
Slc10a6 T C 5: 103,606,684 D327G probably benign Het
Syt1 A T 10: 108,631,821 V205D possibly damaging Het
Tep1 C T 14: 50,827,055 probably null Het
Thnsl2 T A 6: 71,134,191 Q231L probably damaging Het
Ttc4 T A 4: 106,667,566 H304L probably damaging Het
Unc5c G A 3: 141,828,543 V923M possibly damaging Het
Zfp777 T C 6: 48,025,770 E506G probably benign Het
Other mutations in Nhsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Nhsl1 APN 10 18527609 missense probably benign 0.07
IGL01121:Nhsl1 APN 10 18511710 missense probably damaging 1.00
IGL01775:Nhsl1 APN 10 18524474 missense probably damaging 0.99
IGL02143:Nhsl1 APN 10 18511635 missense possibly damaging 0.74
IGL02606:Nhsl1 APN 10 18511637 missense probably damaging 1.00
IGL02642:Nhsl1 APN 10 18408390 missense possibly damaging 0.96
IGL02866:Nhsl1 APN 10 18527607 missense probably damaging 0.99
IGL03263:Nhsl1 APN 10 18498079 nonsense probably null
IGL03380:Nhsl1 APN 10 18523879 nonsense probably null
PIT4651001:Nhsl1 UTSW 10 18408435 missense probably damaging 0.98
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0116:Nhsl1 UTSW 10 18525242 nonsense probably null
R0245:Nhsl1 UTSW 10 18525108 missense probably damaging 1.00
R0254:Nhsl1 UTSW 10 18472985 missense probably damaging 1.00
R0288:Nhsl1 UTSW 10 18524046 missense probably damaging 1.00
R0648:Nhsl1 UTSW 10 18531726 missense possibly damaging 0.92
R1055:Nhsl1 UTSW 10 18525475 missense probably benign 0.08
R1384:Nhsl1 UTSW 10 18408513 missense probably null 0.96
R1453:Nhsl1 UTSW 10 18531575 missense probably damaging 1.00
R1523:Nhsl1 UTSW 10 18408355 missense probably benign
R1595:Nhsl1 UTSW 10 18526348 missense probably damaging 0.98
R1786:Nhsl1 UTSW 10 18524664 missense probably benign 0.28
R1836:Nhsl1 UTSW 10 18524905 missense possibly damaging 0.87
R1878:Nhsl1 UTSW 10 18524279 missense probably damaging 1.00
R2013:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2014:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2015:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R3115:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3116:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3754:Nhsl1 UTSW 10 18516034 missense probably damaging 0.99
R4342:Nhsl1 UTSW 10 18526689 missense probably damaging 1.00
R4595:Nhsl1 UTSW 10 18527609 missense probably benign 0.07
R4604:Nhsl1 UTSW 10 18531410 missense probably damaging 0.99
R4666:Nhsl1 UTSW 10 18531405 missense probably damaging 1.00
R5223:Nhsl1 UTSW 10 18526326 missense probably damaging 1.00
R5258:Nhsl1 UTSW 10 18524322 nonsense probably null
R5707:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R5796:Nhsl1 UTSW 10 18524250 missense probably benign 0.06
R5960:Nhsl1 UTSW 10 18526976 missense probably benign
R6190:Nhsl1 UTSW 10 18470041 intron probably benign
R6272:Nhsl1 UTSW 10 18524505 missense probably benign 0.01
R6677:Nhsl1 UTSW 10 18525862 missense probably damaging 0.98
R6714:Nhsl1 UTSW 10 18524711 missense possibly damaging 0.74
R6765:Nhsl1 UTSW 10 18531314 missense probably benign 0.01
R6892:Nhsl1 UTSW 10 18524343 missense probably damaging 1.00
R7049:Nhsl1 UTSW 10 18531638 missense probably damaging 0.99
R7060:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R7236:Nhsl1 UTSW 10 18525764 missense probably damaging 1.00
R7299:Nhsl1 UTSW 10 18527671 splice site probably null
R7305:Nhsl1 UTSW 10 18531686 missense possibly damaging 0.94
R7513:Nhsl1 UTSW 10 18523952 missense probably damaging 1.00
R7566:Nhsl1 UTSW 10 18516119 missense probably damaging 1.00
R8008:Nhsl1 UTSW 10 18408438 missense probably damaging 0.96
R8135:Nhsl1 UTSW 10 18531432 missense probably damaging 1.00
R8240:Nhsl1 UTSW 10 18526739 missense probably benign 0.34
R8391:Nhsl1 UTSW 10 18524943 missense possibly damaging 0.67
R8396:Nhsl1 UTSW 10 18525162 missense probably benign 0.00
R8752:Nhsl1 UTSW 10 18531365 missense probably benign 0.01
R9022:Nhsl1 UTSW 10 18527661 missense possibly damaging 0.74
R9087:Nhsl1 UTSW 10 18531282 missense probably damaging 1.00
R9360:Nhsl1 UTSW 10 18319150 missense probably damaging 1.00
R9396:Nhsl1 UTSW 10 18524001 missense probably damaging 1.00
R9665:Nhsl1 UTSW 10 18525851 missense possibly damaging 0.53
R9673:Nhsl1 UTSW 10 18526917 missense possibly damaging 0.87
Z1177:Nhsl1 UTSW 10 18526589 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTAATCGGGCACGCAGAAGCAC -3'
(R):5'- TGCGGCAAACAACAGCTATTTAACC -3'

Sequencing Primer
(F):5'- CCCGACTCTCAGCGTTAAG -3'
(R):5'- TTAACCTTCTGGGAAGGCTACAC -3'
Posted On 2014-02-18