Incidental Mutation 'R1300:Syt1'
ID158312
Institutional Source Beutler Lab
Gene Symbol Syt1
Ensembl Gene ENSMUSG00000035864
Gene Namesynaptotagmin I
Synonyms
MMRRC Submission 039366-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1300 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location108497650-109010982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108631821 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 205 (V205D)
Ref Sequence ENSEMBL: ENSMUSP00000100912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064054] [ENSMUST00000105276]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064054
AA Change: V205D

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063293
Gene: ENSMUSG00000035864
AA Change: V205D

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:4ISQ|F 32 52 1e-5 PDB
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 131 141 N/A INTRINSIC
C2 157 259 3.2e-25 SMART
C2 288 402 5.8e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105276
AA Change: V205D

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100912
Gene: ENSMUSG00000035864
AA Change: V205D

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:4ISQ|F 32 52 1e-5 PDB
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 131 141 N/A INTRINSIC
C2 157 259 3.2e-25 SMART
C2 288 402 5.9e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156979
SMART Domains Protein: ENSMUSP00000116981
Gene: ENSMUSG00000035864

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:4ISQ|F 32 52 7e-6 PDB
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 128 138 N/A INTRINSIC
C2 154 236 2.83e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptotagmins are integral membrane proteins of synaptic vesicles thought to serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis. Calcium binding to synaptotagmin-1 participates in triggering neurotransmitter release at the synapse (Fernandez-Chacon et al., 2001 [PubMed 11242035]).[supplied by OMIM, Jul 2010]
PHENOTYPE: Homozygous null mice do not suckle, show impaired synaptic transmission and Ca2+-evoked neurotransmitter release, and die by 48 hrs of life. Knock-in mice bearing a missense mutation show enhanced synaptic depression while those carrying a point mutationshow reduced synaptic release probability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,244,808 I2535T probably damaging Het
Ank3 A G 10: 70,004,665 I952V probably benign Het
Ankar A C 1: 72,643,164 V1414G probably benign Het
Arl2 A G 19: 6,141,073 M10T probably benign Het
Arpp21 A G 9: 112,143,374 I352T probably damaging Het
BC067074 T C 13: 113,366,160 F133S probably damaging Het
Cacna1e T A 1: 154,398,673 H2162L probably benign Het
Cep170b A C 12: 112,737,257 M622L probably benign Het
Cped1 T C 6: 22,119,553 V337A probably benign Het
Cpn2 T A 16: 30,259,663 T407S probably benign Het
Cpne4 T C 9: 104,993,134 W263R probably damaging Het
Crtc1 A G 8: 70,387,539 probably null Het
Dennd5a A T 7: 109,919,407 I485N probably benign Het
Dnah6 T C 6: 73,124,709 Q1892R probably benign Het
Dse G A 10: 34,152,415 A893V probably benign Het
Dsg1a T G 18: 20,332,149 S466A probably benign Het
Dstyk T C 1: 132,449,913 V419A probably benign Het
Eif2ak4 T C 2: 118,463,983 V1125A possibly damaging Het
Ep400 C A 5: 110,673,560 G2576C probably damaging Het
Eps15l1 A T 8: 72,391,902 D162E probably damaging Het
Fstl4 C A 11: 53,068,627 T165N probably benign Het
Gm5346 A T 8: 43,626,844 Y114* probably null Het
Gm6904 A T 14: 59,251,114 V78D probably damaging Het
Gm8674 T C 13: 49,901,722 noncoding transcript Het
Gtsf2 T A 15: 103,444,353 L39F possibly damaging Het
Hck A C 2: 153,134,147 D202A possibly damaging Het
Il12b T A 11: 44,408,076 probably null Het
Irf4 T C 13: 30,757,585 L307P probably damaging Het
Keg1 G A 19: 12,719,004 R184Q probably damaging Het
Kmt2c T C 5: 25,405,454 D218G probably damaging Het
Map1b T C 13: 99,432,521 K1231E unknown Het
Mapkbp1 T C 2: 120,013,655 Y293H probably benign Het
Mfsd8 A T 3: 40,823,898 D310E probably benign Het
Mmp9 A T 2: 164,948,956 D88V probably damaging Het
Muc5ac G T 7: 141,816,929 C2522F possibly damaging Het
Myo1e A T 9: 70,301,783 I110F probably damaging Het
Neu1 A T 17: 34,934,338 Y279F possibly damaging Het
Nhsl1 A G 10: 18,408,461 H50R probably benign Het
Nlrp3 C T 11: 59,555,768 S780F possibly damaging Het
Npc1l1 T G 11: 6,227,859 D517A probably damaging Het
Olfr299 T C 7: 86,465,743 F111L probably benign Het
Olfr30 T C 11: 58,455,841 Y36C probably damaging Het
Olfr392 T C 11: 73,814,246 T279A probably benign Het
Olfr594 G A 7: 103,220,117 R133Q probably benign Het
P3h2 C A 16: 25,997,236 E176* probably null Het
Parp10 C A 15: 76,241,990 D333Y possibly damaging Het
Pcdhb12 C T 18: 37,437,397 A532V possibly damaging Het
Pde2a A T 7: 101,510,404 T818S possibly damaging Het
Phip A T 9: 82,876,747 L1450Q probably benign Het
Pinx1 A G 14: 63,919,410 E262G probably benign Het
Ppargc1a T C 5: 51,548,672 E19G probably damaging Het
Pum1 T C 4: 130,765,961 I921T probably damaging Het
Rgs22 T A 15: 36,101,762 H106L probably benign Het
Slc10a6 T C 5: 103,606,684 D327G probably benign Het
Tep1 C T 14: 50,827,055 probably null Het
Thnsl2 T A 6: 71,134,191 Q231L probably damaging Het
Ttc4 T A 4: 106,667,566 H304L probably damaging Het
Unc5c G A 3: 141,828,543 V923M possibly damaging Het
Zfp777 T C 6: 48,025,770 E506G probably benign Het
Other mutations in Syt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01793:Syt1 APN 10 108583975 missense possibly damaging 0.49
R1067:Syt1 UTSW 10 108636662 missense probably benign
R1370:Syt1 UTSW 10 108690922 missense probably damaging 0.98
R1575:Syt1 UTSW 10 108504500 missense probably benign 0.04
R1656:Syt1 UTSW 10 108583915 missense probably damaging 1.00
R2072:Syt1 UTSW 10 108583972 missense probably damaging 1.00
R2212:Syt1 UTSW 10 108504414 missense possibly damaging 0.89
R2429:Syt1 UTSW 10 108690920 missense possibly damaging 0.86
R4928:Syt1 UTSW 10 108504512 missense possibly damaging 0.95
R5216:Syt1 UTSW 10 108642257 missense probably benign 0.00
R6161:Syt1 UTSW 10 108631807 missense probably damaging 1.00
R6193:Syt1 UTSW 10 108500736 missense probably benign 0.38
R7033:Syt1 UTSW 10 108690936 missense probably benign
R7535:Syt1 UTSW 10 108627422 critical splice acceptor site probably null
R7574:Syt1 UTSW 10 108504401 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTCTGACTGCAACAGGCCATAC -3'
(R):5'- TGCATGGACCCTCTCTATTCAGGTG -3'

Sequencing Primer
(F):5'- GTCTGAGTCCATAGCAATACCTGG -3'
(R):5'- TCTATTCAGGTGCATGGGAATAAAAG -3'
Posted On2014-02-18