Incidental Mutation 'R1300:Nlrp3'
ID 158317
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 039366-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R1300 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 59446594 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 780 (S780F)
Ref Sequence ENSEMBL: ENSMUSP00000098707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148]
AlphaFold Q8R4B8
Predicted Effect possibly damaging
Transcript: ENSMUST00000079476
AA Change: S780F

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: S780F

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101148
AA Change: S780F

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: S780F

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,967 (GRCm39) I2535T probably damaging Het
Adam34l A T 8: 44,079,881 (GRCm39) Y114* probably null Het
Ank3 A G 10: 69,840,495 (GRCm39) I952V probably benign Het
Ankar A C 1: 72,682,323 (GRCm39) V1414G probably benign Het
Arl2 A G 19: 6,191,103 (GRCm39) M10T probably benign Het
Arpp21 A G 9: 111,972,442 (GRCm39) I352T probably damaging Het
Cacna1e T A 1: 154,274,419 (GRCm39) H2162L probably benign Het
Cep170b A C 12: 112,703,691 (GRCm39) M622L probably benign Het
Cped1 T C 6: 22,119,552 (GRCm39) V337A probably benign Het
Cpn2 T A 16: 30,078,481 (GRCm39) T407S probably benign Het
Cpne4 T C 9: 104,870,333 (GRCm39) W263R probably damaging Het
Crtc1 A G 8: 70,840,189 (GRCm39) probably null Het
Cspg4b T C 13: 113,502,694 (GRCm39) F133S probably damaging Het
Dennd5a A T 7: 109,518,614 (GRCm39) I485N probably benign Het
Dnah6 T C 6: 73,101,692 (GRCm39) Q1892R probably benign Het
Dse G A 10: 34,028,411 (GRCm39) A893V probably benign Het
Dsg1a T G 18: 20,465,206 (GRCm39) S466A probably benign Het
Dstyk T C 1: 132,377,651 (GRCm39) V419A probably benign Het
Eif2ak4 T C 2: 118,294,464 (GRCm39) V1125A possibly damaging Het
Ep400 C A 5: 110,821,426 (GRCm39) G2576C probably damaging Het
Eps15l1 A T 8: 73,145,746 (GRCm39) D162E probably damaging Het
Fstl4 C A 11: 52,959,454 (GRCm39) T165N probably benign Het
Gm8674 T C 13: 50,055,758 (GRCm39) noncoding transcript Het
Gtsf2 T A 15: 103,352,780 (GRCm39) L39F possibly damaging Het
Hck A C 2: 152,976,067 (GRCm39) D202A possibly damaging Het
Il12b T A 11: 44,298,903 (GRCm39) probably null Het
Irf4 T C 13: 30,941,568 (GRCm39) L307P probably damaging Het
Keg1 G A 19: 12,696,368 (GRCm39) R184Q probably damaging Het
Kmt2c T C 5: 25,610,452 (GRCm39) D218G probably damaging Het
Map1b T C 13: 99,569,029 (GRCm39) K1231E unknown Het
Mapkbp1 T C 2: 119,844,136 (GRCm39) Y293H probably benign Het
Mfsd8 A T 3: 40,778,333 (GRCm39) D310E probably benign Het
Mmp9 A T 2: 164,790,876 (GRCm39) D88V probably damaging Het
Muc5ac G T 7: 141,370,666 (GRCm39) C2522F possibly damaging Het
Myo1e A T 9: 70,209,065 (GRCm39) I110F probably damaging Het
Neu1 A T 17: 35,153,314 (GRCm39) Y279F possibly damaging Het
Nhsl1 A G 10: 18,284,209 (GRCm39) H50R probably benign Het
Npc1l1 T G 11: 6,177,859 (GRCm39) D517A probably damaging Het
Or14c43 T C 7: 86,114,951 (GRCm39) F111L probably benign Het
Or1e32 T C 11: 73,705,072 (GRCm39) T279A probably benign Het
Or2z2 T C 11: 58,346,667 (GRCm39) Y36C probably damaging Het
Or52e3 G A 7: 102,869,324 (GRCm39) R133Q probably benign Het
P3h2 C A 16: 25,815,986 (GRCm39) E176* probably null Het
Parp10 C A 15: 76,126,190 (GRCm39) D333Y possibly damaging Het
Pcdhb12 C T 18: 37,570,450 (GRCm39) A532V possibly damaging Het
Pde2a A T 7: 101,159,611 (GRCm39) T818S possibly damaging Het
Phf11 A T 14: 59,488,563 (GRCm39) V78D probably damaging Het
Phip A T 9: 82,758,800 (GRCm39) L1450Q probably benign Het
Pinx1 A G 14: 64,156,859 (GRCm39) E262G probably benign Het
Ppargc1a T C 5: 51,706,014 (GRCm39) E19G probably damaging Het
Pum1 T C 4: 130,493,272 (GRCm39) I921T probably damaging Het
Rgs22 T A 15: 36,101,908 (GRCm39) H106L probably benign Het
Slc10a6 T C 5: 103,754,550 (GRCm39) D327G probably benign Het
Syt1 A T 10: 108,467,682 (GRCm39) V205D possibly damaging Het
Tep1 C T 14: 51,064,512 (GRCm39) probably null Het
Thnsl2 T A 6: 71,111,175 (GRCm39) Q231L probably damaging Het
Ttc4 T A 4: 106,524,763 (GRCm39) H304L probably damaging Het
Unc5c G A 3: 141,534,304 (GRCm39) V923M possibly damaging Het
Zfp777 T C 6: 48,002,704 (GRCm39) E506G probably benign Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACACATCGGGCTCCTGCTGAATAC -3'
(R):5'- GTAGGCCAGACTCACCACAGTTTC -3'

Sequencing Primer
(F):5'- aaggaacaaaggaggaagagag -3'
(R):5'- TTCTGGAGGTTGCAGAGC -3'
Posted On 2014-02-18