Incidental Mutation 'R1300:Gm8674'
ID158323
Institutional Source Beutler Lab
Gene Symbol Gm8674
Ensembl Gene ENSMUSG00000093976
Gene Namepredicted gene 8674
Synonyms
MMRRC Submission 039366-MU
Accession Numbers

Genbank: XM_990959; MGI: 3645762

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1300 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location49899119-49904597 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 49901722 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179367
SMART Domains Protein: ENSMUSP00000137219
Gene: ENSMUSG00000093976

DomainStartEndE-ValueType
low complexity region 70 86 N/A INTRINSIC
Pfam:FAM75 92 444 3.6e-27 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,244,808 I2535T probably damaging Het
Ank3 A G 10: 70,004,665 I952V probably benign Het
Ankar A C 1: 72,643,164 V1414G probably benign Het
Arl2 A G 19: 6,141,073 M10T probably benign Het
Arpp21 A G 9: 112,143,374 I352T probably damaging Het
BC067074 T C 13: 113,366,160 F133S probably damaging Het
Cacna1e T A 1: 154,398,673 H2162L probably benign Het
Cep170b A C 12: 112,737,257 M622L probably benign Het
Cped1 T C 6: 22,119,553 V337A probably benign Het
Cpn2 T A 16: 30,259,663 T407S probably benign Het
Cpne4 T C 9: 104,993,134 W263R probably damaging Het
Crtc1 A G 8: 70,387,539 probably null Het
Dennd5a A T 7: 109,919,407 I485N probably benign Het
Dnah6 T C 6: 73,124,709 Q1892R probably benign Het
Dse G A 10: 34,152,415 A893V probably benign Het
Dsg1a T G 18: 20,332,149 S466A probably benign Het
Dstyk T C 1: 132,449,913 V419A probably benign Het
Eif2ak4 T C 2: 118,463,983 V1125A possibly damaging Het
Ep400 C A 5: 110,673,560 G2576C probably damaging Het
Eps15l1 A T 8: 72,391,902 D162E probably damaging Het
Fstl4 C A 11: 53,068,627 T165N probably benign Het
Gm5346 A T 8: 43,626,844 Y114* probably null Het
Gm6904 A T 14: 59,251,114 V78D probably damaging Het
Gtsf2 T A 15: 103,444,353 L39F possibly damaging Het
Hck A C 2: 153,134,147 D202A possibly damaging Het
Il12b T A 11: 44,408,076 probably null Het
Irf4 T C 13: 30,757,585 L307P probably damaging Het
Keg1 G A 19: 12,719,004 R184Q probably damaging Het
Kmt2c T C 5: 25,405,454 D218G probably damaging Het
Map1b T C 13: 99,432,521 K1231E unknown Het
Mapkbp1 T C 2: 120,013,655 Y293H probably benign Het
Mfsd8 A T 3: 40,823,898 D310E probably benign Het
Mmp9 A T 2: 164,948,956 D88V probably damaging Het
Muc5ac G T 7: 141,816,929 C2522F possibly damaging Het
Myo1e A T 9: 70,301,783 I110F probably damaging Het
Neu1 A T 17: 34,934,338 Y279F possibly damaging Het
Nhsl1 A G 10: 18,408,461 H50R probably benign Het
Nlrp3 C T 11: 59,555,768 S780F possibly damaging Het
Npc1l1 T G 11: 6,227,859 D517A probably damaging Het
Olfr299 T C 7: 86,465,743 F111L probably benign Het
Olfr30 T C 11: 58,455,841 Y36C probably damaging Het
Olfr392 T C 11: 73,814,246 T279A probably benign Het
Olfr594 G A 7: 103,220,117 R133Q probably benign Het
P3h2 C A 16: 25,997,236 E176* probably null Het
Parp10 C A 15: 76,241,990 D333Y possibly damaging Het
Pcdhb12 C T 18: 37,437,397 A532V possibly damaging Het
Pde2a A T 7: 101,510,404 T818S possibly damaging Het
Phip A T 9: 82,876,747 L1450Q probably benign Het
Pinx1 A G 14: 63,919,410 E262G probably benign Het
Ppargc1a T C 5: 51,548,672 E19G probably damaging Het
Pum1 T C 4: 130,765,961 I921T probably damaging Het
Rgs22 T A 15: 36,101,762 H106L probably benign Het
Slc10a6 T C 5: 103,606,684 D327G probably benign Het
Syt1 A T 10: 108,631,821 V205D possibly damaging Het
Tep1 C T 14: 50,827,055 probably null Het
Thnsl2 T A 6: 71,134,191 Q231L probably damaging Het
Ttc4 T A 4: 106,667,566 H304L probably damaging Het
Unc5c G A 3: 141,828,543 V923M possibly damaging Het
Zfp777 T C 6: 48,025,770 E506G probably benign Het
Other mutations in Gm8674
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0355:Gm8674 UTSW 13 49901939 exon noncoding transcript
R0357:Gm8674 UTSW 13 49902113 exon noncoding transcript
R0627:Gm8674 UTSW 13 49899715 exon noncoding transcript
R0833:Gm8674 UTSW 13 49904575 exon noncoding transcript
R1452:Gm8674 UTSW 13 49900517 exon noncoding transcript
R1542:Gm8674 UTSW 13 49900003 exon noncoding transcript
R1613:Gm8674 UTSW 13 49902438 intron noncoding transcript
R1643:Gm8674 UTSW 13 49901358 exon noncoding transcript
R1732:Gm8674 UTSW 13 49901926 exon noncoding transcript
R1824:Gm8674 UTSW 13 49900808 exon noncoding transcript
R1840:Gm8674 UTSW 13 49901765 exon noncoding transcript
R1915:Gm8674 UTSW 13 49900853 exon noncoding transcript
R1934:Gm8674 UTSW 13 49901435 exon noncoding transcript
R2040:Gm8674 UTSW 13 49901669 exon noncoding transcript
R2214:Gm8674 UTSW 13 49901360 exon noncoding transcript
R2421:Gm8674 UTSW 13 49900663 exon noncoding transcript
R3423:Gm8674 UTSW 13 49901756 exon noncoding transcript
R3425:Gm8674 UTSW 13 49901756 exon noncoding transcript
R3886:Gm8674 UTSW 13 49902163 splice site noncoding transcript
R4083:Gm8674 UTSW 13 49901011 exon noncoding transcript
R4343:Gm8674 UTSW 13 49899706 exon noncoding transcript
R4570:Gm8674 UTSW 13 49902534 intron noncoding transcript
R4936:Gm8674 UTSW 13 49900755 exon noncoding transcript
R4967:Gm8674 UTSW 13 49901998 exon noncoding transcript
R5065:Gm8674 UTSW 13 49902577 intron noncoding transcript
R5067:Gm8674 UTSW 13 49899834 exon noncoding transcript
R5120:Gm8674 UTSW 13 49901948 exon noncoding transcript
R5208:Gm8674 UTSW 13 49901921 exon noncoding transcript
R5268:Gm8674 UTSW 13 49901354 exon noncoding transcript
R5471:Gm8674 UTSW 13 49900813 exon noncoding transcript
R5773:Gm8674 UTSW 13 49901876 exon noncoding transcript
R5809:Gm8674 UTSW 13 49901888 exon noncoding transcript
Z1088:Gm8674 UTSW 13 49900794 exon noncoding transcript
Z1088:Gm8674 UTSW 13 49901248 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GGGAAACATTCCTGAAGCTGGGTC -3'
(R):5'- ACCTGCCATTGCCTCTGGAAATTG -3'

Sequencing Primer
(F):5'- CAGTTTCTGGGATAGGAGGAATC -3'
(R):5'- GCCTCTGGAAATTGTGACAC -3'
Posted On2014-02-18