Incidental Mutation 'R1300:Keg1'
ID 158339
Institutional Source Beutler Lab
Gene Symbol Keg1
Ensembl Gene ENSMUSG00000024694
Gene Name kidney expressed gene 1
Synonyms 0610008P16Rik, GS4059
MMRRC Submission 039366-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R1300 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 12673154-12697266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 12696368 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 184 (R184Q)
Ref Sequence ENSEMBL: ENSMUSP00000119879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025598] [ENSMUST00000138545] [ENSMUST00000154822]
AlphaFold Q9DCY0
Predicted Effect possibly damaging
Transcript: ENSMUST00000025598
AA Change: R237Q

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025598
Gene: ENSMUSG00000024694
AA Change: R237Q

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 205 1.2e-89 PFAM
Pfam:Gly_acyl_tr_C 206 294 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128987
Predicted Effect probably damaging
Transcript: ENSMUST00000138545
AA Change: R227Q

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116555
Gene: ENSMUSG00000024694
AA Change: R227Q

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 195 4.2e-96 PFAM
Pfam:Gly_acyl_tr_C 196 228 4.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152017
Predicted Effect probably damaging
Transcript: ENSMUST00000154822
AA Change: R184Q

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119879
Gene: ENSMUSG00000024694
AA Change: R184Q

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 156 1.2e-71 PFAM
Pfam:Gly_acyl_tr_C 153 221 3.2e-37 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,283,967 (GRCm39) I2535T probably damaging Het
Adam34l A T 8: 44,079,881 (GRCm39) Y114* probably null Het
Ank3 A G 10: 69,840,495 (GRCm39) I952V probably benign Het
Ankar A C 1: 72,682,323 (GRCm39) V1414G probably benign Het
Arl2 A G 19: 6,191,103 (GRCm39) M10T probably benign Het
Arpp21 A G 9: 111,972,442 (GRCm39) I352T probably damaging Het
Cacna1e T A 1: 154,274,419 (GRCm39) H2162L probably benign Het
Cep170b A C 12: 112,703,691 (GRCm39) M622L probably benign Het
Cped1 T C 6: 22,119,552 (GRCm39) V337A probably benign Het
Cpn2 T A 16: 30,078,481 (GRCm39) T407S probably benign Het
Cpne4 T C 9: 104,870,333 (GRCm39) W263R probably damaging Het
Crtc1 A G 8: 70,840,189 (GRCm39) probably null Het
Cspg4b T C 13: 113,502,694 (GRCm39) F133S probably damaging Het
Dennd5a A T 7: 109,518,614 (GRCm39) I485N probably benign Het
Dnah6 T C 6: 73,101,692 (GRCm39) Q1892R probably benign Het
Dse G A 10: 34,028,411 (GRCm39) A893V probably benign Het
Dsg1a T G 18: 20,465,206 (GRCm39) S466A probably benign Het
Dstyk T C 1: 132,377,651 (GRCm39) V419A probably benign Het
Eif2ak4 T C 2: 118,294,464 (GRCm39) V1125A possibly damaging Het
Ep400 C A 5: 110,821,426 (GRCm39) G2576C probably damaging Het
Eps15l1 A T 8: 73,145,746 (GRCm39) D162E probably damaging Het
Fstl4 C A 11: 52,959,454 (GRCm39) T165N probably benign Het
Gm8674 T C 13: 50,055,758 (GRCm39) noncoding transcript Het
Gtsf2 T A 15: 103,352,780 (GRCm39) L39F possibly damaging Het
Hck A C 2: 152,976,067 (GRCm39) D202A possibly damaging Het
Il12b T A 11: 44,298,903 (GRCm39) probably null Het
Irf4 T C 13: 30,941,568 (GRCm39) L307P probably damaging Het
Kmt2c T C 5: 25,610,452 (GRCm39) D218G probably damaging Het
Map1b T C 13: 99,569,029 (GRCm39) K1231E unknown Het
Mapkbp1 T C 2: 119,844,136 (GRCm39) Y293H probably benign Het
Mfsd8 A T 3: 40,778,333 (GRCm39) D310E probably benign Het
Mmp9 A T 2: 164,790,876 (GRCm39) D88V probably damaging Het
Muc5ac G T 7: 141,370,666 (GRCm39) C2522F possibly damaging Het
Myo1e A T 9: 70,209,065 (GRCm39) I110F probably damaging Het
Neu1 A T 17: 35,153,314 (GRCm39) Y279F possibly damaging Het
Nhsl1 A G 10: 18,284,209 (GRCm39) H50R probably benign Het
Nlrp3 C T 11: 59,446,594 (GRCm39) S780F possibly damaging Het
Npc1l1 T G 11: 6,177,859 (GRCm39) D517A probably damaging Het
Or14c43 T C 7: 86,114,951 (GRCm39) F111L probably benign Het
Or1e32 T C 11: 73,705,072 (GRCm39) T279A probably benign Het
Or2z2 T C 11: 58,346,667 (GRCm39) Y36C probably damaging Het
Or52e3 G A 7: 102,869,324 (GRCm39) R133Q probably benign Het
P3h2 C A 16: 25,815,986 (GRCm39) E176* probably null Het
Parp10 C A 15: 76,126,190 (GRCm39) D333Y possibly damaging Het
Pcdhb12 C T 18: 37,570,450 (GRCm39) A532V possibly damaging Het
Pde2a A T 7: 101,159,611 (GRCm39) T818S possibly damaging Het
Phf11 A T 14: 59,488,563 (GRCm39) V78D probably damaging Het
Phip A T 9: 82,758,800 (GRCm39) L1450Q probably benign Het
Pinx1 A G 14: 64,156,859 (GRCm39) E262G probably benign Het
Ppargc1a T C 5: 51,706,014 (GRCm39) E19G probably damaging Het
Pum1 T C 4: 130,493,272 (GRCm39) I921T probably damaging Het
Rgs22 T A 15: 36,101,908 (GRCm39) H106L probably benign Het
Slc10a6 T C 5: 103,754,550 (GRCm39) D327G probably benign Het
Syt1 A T 10: 108,467,682 (GRCm39) V205D possibly damaging Het
Tep1 C T 14: 51,064,512 (GRCm39) probably null Het
Thnsl2 T A 6: 71,111,175 (GRCm39) Q231L probably damaging Het
Ttc4 T A 4: 106,524,763 (GRCm39) H304L probably damaging Het
Unc5c G A 3: 141,534,304 (GRCm39) V923M possibly damaging Het
Zfp777 T C 6: 48,002,704 (GRCm39) E506G probably benign Het
Other mutations in Keg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Keg1 APN 19 12,696,364 (GRCm39) missense probably damaging 1.00
IGL01084:Keg1 APN 19 12,691,976 (GRCm39) missense probably damaging 1.00
IGL02563:Keg1 APN 19 12,696,521 (GRCm39) missense probably damaging 1.00
IGL03328:Keg1 APN 19 12,696,461 (GRCm39) missense probably damaging 1.00
R0103:Keg1 UTSW 19 12,696,280 (GRCm39) missense possibly damaging 0.79
R0103:Keg1 UTSW 19 12,696,280 (GRCm39) missense possibly damaging 0.79
R0417:Keg1 UTSW 19 12,688,424 (GRCm39) missense probably damaging 1.00
R1476:Keg1 UTSW 19 12,693,387 (GRCm39) missense probably benign
R1482:Keg1 UTSW 19 12,696,185 (GRCm39) missense probably damaging 1.00
R1643:Keg1 UTSW 19 12,696,406 (GRCm39) missense probably benign 0.00
R4002:Keg1 UTSW 19 12,696,307 (GRCm39) missense possibly damaging 0.95
R5022:Keg1 UTSW 19 12,696,521 (GRCm39) missense probably damaging 1.00
R5164:Keg1 UTSW 19 12,692,044 (GRCm39) intron probably benign
R5386:Keg1 UTSW 19 12,691,902 (GRCm39) missense probably damaging 1.00
R6289:Keg1 UTSW 19 12,691,937 (GRCm39) missense probably damaging 0.98
R6517:Keg1 UTSW 19 12,693,274 (GRCm39) missense probably benign 0.00
R6656:Keg1 UTSW 19 12,686,994 (GRCm39) nonsense probably null
R7117:Keg1 UTSW 19 12,687,042 (GRCm39) missense probably damaging 1.00
R7676:Keg1 UTSW 19 12,693,409 (GRCm39) missense probably benign 0.00
R7807:Keg1 UTSW 19 12,691,998 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCATTTTGGTGGCAATGAGAAGAGC -3'
(R):5'- GCATGGATCAATGAGCCAGCAAAAC -3'

Sequencing Primer
(F):5'- CCAGAAGTTCATTGAACGCTG -3'
(R):5'- AGCTTTATAGCGGTACACAGTTCC -3'
Posted On 2014-02-18