Incidental Mutation 'R1301:Hsd17b7'
ID158343
Institutional Source Beutler Lab
Gene Symbol Hsd17b7
Ensembl Gene ENSMUSG00000026675
Gene Namehydroxysteroid (17-beta) dehydrogenase 7
SynonymsERG27
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1301 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location169949535-169969241 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 169961205 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027989] [ENSMUST00000111353]
Predicted Effect probably benign
Transcript: ENSMUST00000027989
SMART Domains Protein: ENSMUSP00000027989
Gene: ENSMUSG00000026675

DomainStartEndE-ValueType
Pfam:adh_short 3 104 2.2e-16 PFAM
Pfam:KR 4 102 2.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111353
SMART Domains Protein: ENSMUSP00000106985
Gene: ENSMUSG00000026675

DomainStartEndE-ValueType
Pfam:KR 3 103 2.3e-8 PFAM
Pfam:adh_short 3 236 5.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133563
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HSD17B7 encodes an enzyme that functions both as a 17-beta-hydroxysteroid dehydrogenase (EC 1.1.1.62) in the biosynthesis of sex steroids and as a 3-ketosteroid reductase (EC 1.1.1.270) in the biosynthesis of cholesterol (Marijanovic et al., 2003 [PubMed 12829805]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality, abnormal brain development, abnormal branchial arches, pericardial effusion, and abnormal cardiovascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Hsd17b7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Hsd17b7 APN 1 169965755 nonsense probably null
IGL01923:Hsd17b7 APN 1 169959466 missense probably benign
IGL02628:Hsd17b7 APN 1 169964489 missense possibly damaging 0.58
IGL02830:Hsd17b7 APN 1 169953080 missense probably damaging 0.98
IGL02886:Hsd17b7 APN 1 169953080 missense probably damaging 0.98
IGL03064:Hsd17b7 APN 1 169959718 missense probably benign 0.35
IGL03123:Hsd17b7 APN 1 169953080 missense probably damaging 0.98
IGL03139:Hsd17b7 APN 1 169953080 missense probably damaging 0.98
IGL03165:Hsd17b7 APN 1 169953080 missense probably damaging 0.98
IGL03270:Hsd17b7 APN 1 169953080 missense probably damaging 0.98
IGL03389:Hsd17b7 APN 1 169959751 missense probably damaging 1.00
IGL03098:Hsd17b7 UTSW 1 169953080 missense probably damaging 0.98
IGL03138:Hsd17b7 UTSW 1 169953080 missense probably damaging 0.98
R0299:Hsd17b7 UTSW 1 169959794 splice site probably benign
R0723:Hsd17b7 UTSW 1 169956026 missense probably damaging 1.00
R1449:Hsd17b7 UTSW 1 169959682 splice site probably null
R1806:Hsd17b7 UTSW 1 169961129 missense possibly damaging 0.50
R1874:Hsd17b7 UTSW 1 169955993 missense possibly damaging 0.70
R2365:Hsd17b7 UTSW 1 169964440 missense probably damaging 1.00
R4824:Hsd17b7 UTSW 1 169961195 missense probably benign 0.10
R4859:Hsd17b7 UTSW 1 169967257 missense possibly damaging 0.82
R5644:Hsd17b7 UTSW 1 169955948 missense probably damaging 0.99
R5889:Hsd17b7 UTSW 1 169955918 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGCTTGTCTCTCCCCTAAGAAAC -3'
(R):5'- TGAACAAACCGTAATGTCTGTACCCC -3'

Sequencing Primer
(F):5'- ACTTTGGCATCTCTGAGACAG -3'
(R):5'- GTAATGTCTGTACCCCTTCCTC -3'
Posted On2014-02-18