Mutagenetix > Incidental Mutations

Incidental Mutation 'R1301:Myo3a'

158345

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

039367-MU

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1301 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 22267095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000120573 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000044749

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138850

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142435

Predicted Effect

probably benign
Transcript: ENSMUST00000153002

SMART Domains

Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716

Domain	Start	End	E-Value	Type
S_TKc	21	287	1.62e-91	SMART
MYSc	332	753	3.06e-35	SMART

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.3%
20x: 82.6%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano1	A	G	7: 144,633,689	W447R	possibly damaging	Het
Blm	T	A	7: 80,455,417	K103*	probably null	Het
Camta2	A	G	11: 70,676,404	I675T	probably benign	Het
Catsperz	G	A	19: 6,925,082	R15C	probably damaging	Het
Chd1l	T	C	3: 97,603,648		probably benign	Het
Corin	C	A	5: 72,304,933	E844D	possibly damaging	Het
Cyb5rl	T	G	4: 107,080,907	M127R	probably damaging	Het
Dcdc2a	A	T	13: 25,102,586	N164I	possibly damaging	Het
Dnah6	A	G	6: 73,208,545		probably null	Het
Emilin2	T	C	17: 71,255,965		probably benign	Het
Epb41l2	T	A	10: 25,443,902	V211D	probably damaging	Het
Fbxo47	C	T	11: 97,868,601	M166I	probably benign	Het
Gm13124	T	A	4: 144,565,065	I24L	probably benign	Het
Gm4450	G	A	3: 98,446,866	Q106*	probably null	Het
Golm1	T	C	13: 59,638,373	D335G	probably damaging	Het
Gpn1	T	A	5: 31,503,429	M188K	probably damaging	Het
Gpr84	T	A	15: 103,309,219	S144C	probably damaging	Het
Grm8	G	T	6: 27,981,201	Q237K	possibly damaging	Het
Gsdmd	C	A	15: 75,867,059		probably null	Het
Hmgcr	G	A	13: 96,659,020	T347I	probably damaging	Het
Hsd17b7	T	A	1: 169,961,205		probably benign	Het
Klhl7	T	G	5: 24,159,491	W508G	probably damaging	Het
Lrp2	C	A	2: 69,428,604	D4581Y	probably damaging	Het
Lrrc7	T	C	3: 158,135,331	N1357D	probably benign	Het
Macf1	T	C	4: 123,486,658		probably benign	Het
Mroh7	T	C	4: 106,720,495	T329A	probably damaging	Het
Mroh9	C	T	1: 163,043,983		probably null	Het
Mta2	A	G	19: 8,949,186		probably benign	Het
Nrip2	A	G	6: 128,407,389	D153G	probably benign	Het
Nup133	T	C	8: 123,917,417		probably benign	Het
Nup210	C	T	6: 91,042,347	V259M	possibly damaging	Het
Olfr1338	C	T	4: 118,753,619	M308I	probably benign	Het
Olfr1466	A	T	19: 13,341,847	I30F	probably benign	Het
Olfr1499	A	T	19: 13,815,362	V76D	probably damaging	Het
Otog	C	T	7: 46,289,689	R2048C	probably damaging	Het
Paqr7	T	C	4: 134,507,813	L327P	probably damaging	Het
Parl	A	G	16: 20,286,926	S249P	probably damaging	Het
Phc1	A	G	6: 122,325,874	I230T	probably benign	Het
Pitpnm1	T	G	19: 4,110,831		probably null	Het
Plpp1	A	G	13: 112,834,943	Y48C	probably damaging	Het
Pxdc1	A	G	13: 34,628,887	F194L	probably benign	Het
Rp1	A	T	1: 4,345,936	V1651D	possibly damaging	Het
Serpinb1c	T	A	13: 32,896,960	R47*	probably null	Het
Sis	T	C	3: 72,946,582	T521A	possibly damaging	Het
Slc16a9	A	G	10: 70,282,478	D209G	probably benign	Het
Slc26a4	A	T	12: 31,525,568	C706*	probably null	Het
Slc37a2	A	G	9: 37,236,881	V325A	probably benign	Het
Speg	T	A	1: 75,401,501	D784E	probably damaging	Het
Sycp1	T	C	3: 102,920,622	I270V	probably benign	Het
Tatdn2	T	A	6: 113,704,115	F309I	probably damaging	Het
Tmem206	T	C	1: 191,348,435	V284A	probably damaging	Het
Tmem67	T	C	4: 12,089,400		probably benign	Het
Trpm1	T	A	7: 64,203,053		probably null	Het
Wrn	T	C	8: 33,292,686	R496G	probably damaging	Het
Zfhx2	A	G	14: 55,063,397	V2299A	probably benign	Het
Zfp819	T	A	7: 43,617,100	S260T	possibly damaging	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R3926:Myo3a	UTSW	2	22565041	missense	probably damaging	0.99
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
R8140:Myo3a	UTSW	2	22407346	missense	probably damaging	1.00
R8143:Myo3a	UTSW	2	22282665	critical splice donor site	probably null
R8346:Myo3a	UTSW	2	22558422	critical splice donor site	probably null
R8421:Myo3a	UTSW	2	22362124	missense	probably benign	0.07
R8495:Myo3a	UTSW	2	22396273	missense	probably damaging	0.96
R8551:Myo3a	UTSW	2	22332466	missense	probably benign	0.00
R8708:Myo3a	UTSW	2	22291796	splice site	probably benign
R8757:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8759:Myo3a	UTSW	2	22558307	missense	possibly damaging	0.49
R8779:Myo3a	UTSW	2	22245593	nonsense	probably null
R8828:Myo3a	UTSW	2	22241053	missense	probably benign	0.01
R8910:Myo3a	UTSW	2	22574268	missense	probably benign	0.01
R8916:Myo3a	UTSW	2	22567692	missense	probably damaging	1.00
R8926:Myo3a	UTSW	2	22396263	missense	possibly damaging	0.95
R9028:Myo3a	UTSW	2	22600087	missense	possibly damaging	0.79
R9046:Myo3a	UTSW	2	22558355	missense	probably damaging	0.99
R9120:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R9153:Myo3a	UTSW	2	22399933	missense	probably benign	0.02
R9191:Myo3a	UTSW	2	22579829	missense	probably benign	0.24
R9258:Myo3a	UTSW	2	22577533	missense	possibly damaging	0.60
R9436:Myo3a	UTSW	2	22407424	nonsense	probably null
R9464:Myo3a	UTSW	2	22227572	start gained	probably benign
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GGAGAAAGCTGAGAAGTGTGATCTTGTT -3'
(R):5'- TCGGAGATGCTGCCTGTCCT -3'

Sequencing Primer
(F):5'- TTGGTGACTTTCTACATAGTCCAAG -3'
(R):5'- cacacacacacacacactatg -3'

Posted On

2014-02-18