Incidental Mutation 'R1301:Sis'
ID 158347
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Name sucrase isomaltase
Synonyms 2010204N08Rik, Si-s, sucrase-isomaltase
MMRRC Submission 039367-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1301 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 72795890-72875196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72853915 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 521 (T521A)
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
AlphaFold F8VQM5
Predicted Effect possibly damaging
Transcript: ENSMUST00000094190
AA Change: T521A

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: T521A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167334
AA Change: T521A

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: T521A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191870
Meta Mutation Damage Score 0.1126 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm2 T A 4: 144,291,635 (GRCm39) I24L probably benign Het
Ano1 A G 7: 144,187,426 (GRCm39) W447R possibly damaging Het
Blm T A 7: 80,105,165 (GRCm39) K103* probably null Het
Camta2 A G 11: 70,567,230 (GRCm39) I675T probably benign Het
Catsperz G A 19: 6,902,450 (GRCm39) R15C probably damaging Het
Chd1l T C 3: 97,510,964 (GRCm39) probably benign Het
Corin C A 5: 72,462,276 (GRCm39) E844D possibly damaging Het
Cyb5rl T G 4: 106,938,104 (GRCm39) M127R probably damaging Het
Dcdc2a A T 13: 25,286,569 (GRCm39) N164I possibly damaging Het
Dnah6 A G 6: 73,185,528 (GRCm39) probably null Het
Emilin2 T C 17: 71,562,960 (GRCm39) probably benign Het
Epb41l2 T A 10: 25,319,800 (GRCm39) V211D probably damaging Het
Fbxo47 C T 11: 97,759,427 (GRCm39) M166I probably benign Het
Golm1 T C 13: 59,786,187 (GRCm39) D335G probably damaging Het
Gpn1 T A 5: 31,660,773 (GRCm39) M188K probably damaging Het
Gpr84 T A 15: 103,217,646 (GRCm39) S144C probably damaging Het
Grm8 G T 6: 27,981,200 (GRCm39) Q237K possibly damaging Het
Gsdmd C A 15: 75,738,908 (GRCm39) probably null Het
Hmgcr G A 13: 96,795,528 (GRCm39) T347I probably damaging Het
Hsd17b7 T A 1: 169,788,774 (GRCm39) probably benign Het
Hsd3b9 G A 3: 98,354,182 (GRCm39) Q106* probably null Het
Klhl7 T G 5: 24,364,489 (GRCm39) W508G probably damaging Het
Lrp2 C A 2: 69,258,948 (GRCm39) D4581Y probably damaging Het
Lrrc7 T C 3: 157,840,968 (GRCm39) N1357D probably benign Het
Macf1 T C 4: 123,380,451 (GRCm39) probably benign Het
Mroh7 T C 4: 106,577,692 (GRCm39) T329A probably damaging Het
Mroh9 C T 1: 162,871,552 (GRCm39) probably null Het
Mta2 A G 19: 8,926,550 (GRCm39) probably benign Het
Myo3a A T 2: 22,271,906 (GRCm39) probably benign Het
Nrip2 A G 6: 128,384,352 (GRCm39) D153G probably benign Het
Nup133 T C 8: 124,644,156 (GRCm39) probably benign Het
Nup210 C T 6: 91,019,329 (GRCm39) V259M possibly damaging Het
Or10ak14 C T 4: 118,610,816 (GRCm39) M308I probably benign Het
Or5b112 A T 19: 13,319,211 (GRCm39) I30F probably benign Het
Or9i14 A T 19: 13,792,726 (GRCm39) V76D probably damaging Het
Otog C T 7: 45,939,113 (GRCm39) R2048C probably damaging Het
Pacc1 T C 1: 191,080,632 (GRCm39) V284A probably damaging Het
Paqr7 T C 4: 134,235,124 (GRCm39) L327P probably damaging Het
Parl A G 16: 20,105,676 (GRCm39) S249P probably damaging Het
Phc1 A G 6: 122,302,833 (GRCm39) I230T probably benign Het
Pitpnm1 T G 19: 4,160,831 (GRCm39) probably null Het
Plpp1 A G 13: 112,971,477 (GRCm39) Y48C probably damaging Het
Pxdc1 A G 13: 34,812,870 (GRCm39) F194L probably benign Het
Rp1 A T 1: 4,416,159 (GRCm39) V1651D possibly damaging Het
Serpinb1c T A 13: 33,080,943 (GRCm39) R47* probably null Het
Slc16a9 A G 10: 70,118,308 (GRCm39) D209G probably benign Het
Slc26a4 A T 12: 31,575,567 (GRCm39) C706* probably null Het
Slc37a2 A G 9: 37,148,177 (GRCm39) V325A probably benign Het
Speg T A 1: 75,378,145 (GRCm39) D784E probably damaging Het
Sycp1 T C 3: 102,827,938 (GRCm39) I270V probably benign Het
Tatdn2 T A 6: 113,681,076 (GRCm39) F309I probably damaging Het
Tmem67 T C 4: 12,089,400 (GRCm39) probably benign Het
Trpm1 T A 7: 63,852,801 (GRCm39) probably null Het
Wrn T C 8: 33,782,714 (GRCm39) R496G probably damaging Het
Zfhx2 A G 14: 55,300,854 (GRCm39) V2299A probably benign Het
Zfp819 T A 7: 43,266,524 (GRCm39) S260T possibly damaging Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72,853,969 (GRCm39) missense probably benign
IGL00715:Sis APN 3 72,841,457 (GRCm39) missense probably damaging 1.00
IGL00721:Sis APN 3 72,850,912 (GRCm39) missense probably damaging 1.00
IGL00766:Sis APN 3 72,814,570 (GRCm39) splice site probably benign
IGL00783:Sis APN 3 72,853,965 (GRCm39) missense probably benign
IGL00805:Sis APN 3 72,841,532 (GRCm39) missense probably benign 0.05
IGL00932:Sis APN 3 72,848,289 (GRCm39) splice site probably benign
IGL01020:Sis APN 3 72,874,171 (GRCm39) missense probably damaging 1.00
IGL01024:Sis APN 3 72,819,209 (GRCm39) missense probably damaging 1.00
IGL01286:Sis APN 3 72,848,358 (GRCm39) missense probably damaging 1.00
IGL01457:Sis APN 3 72,868,354 (GRCm39) missense probably benign
IGL01514:Sis APN 3 72,843,253 (GRCm39) splice site probably benign
IGL01986:Sis APN 3 72,852,545 (GRCm39) missense probably damaging 1.00
IGL02110:Sis APN 3 72,836,032 (GRCm39) nonsense probably null
IGL02132:Sis APN 3 72,854,804 (GRCm39) missense probably benign 0.00
IGL02152:Sis APN 3 72,796,319 (GRCm39) utr 3 prime probably benign
IGL02200:Sis APN 3 72,850,937 (GRCm39) missense probably damaging 0.99
IGL02244:Sis APN 3 72,863,523 (GRCm39) missense probably benign 0.19
IGL02307:Sis APN 3 72,819,167 (GRCm39) splice site probably benign
IGL02374:Sis APN 3 72,832,789 (GRCm39) missense probably benign 0.03
IGL02437:Sis APN 3 72,826,947 (GRCm39) critical splice acceptor site probably null
IGL02571:Sis APN 3 72,863,637 (GRCm39) splice site probably benign
IGL02601:Sis APN 3 72,820,543 (GRCm39) missense probably benign 0.44
IGL03063:Sis APN 3 72,835,630 (GRCm39) missense probably benign
IGL03382:Sis APN 3 72,836,052 (GRCm39) missense probably benign 0.00
IGL03397:Sis APN 3 72,843,212 (GRCm39) missense probably benign 0.44
PIT1430001:Sis UTSW 3 72,830,162 (GRCm39) missense probably damaging 0.97
R0013:Sis UTSW 3 72,817,809 (GRCm39) missense possibly damaging 0.65
R0013:Sis UTSW 3 72,817,809 (GRCm39) missense possibly damaging 0.65
R0046:Sis UTSW 3 72,839,427 (GRCm39) missense probably benign 0.01
R0094:Sis UTSW 3 72,828,770 (GRCm39) missense probably damaging 1.00
R0096:Sis UTSW 3 72,835,600 (GRCm39) missense probably damaging 1.00
R0505:Sis UTSW 3 72,867,629 (GRCm39) missense probably benign 0.29
R0544:Sis UTSW 3 72,858,975 (GRCm39) missense probably damaging 1.00
R0551:Sis UTSW 3 72,832,740 (GRCm39) missense possibly damaging 0.79
R0617:Sis UTSW 3 72,872,938 (GRCm39) missense probably damaging 1.00
R0698:Sis UTSW 3 72,817,831 (GRCm39) missense probably damaging 1.00
R0701:Sis UTSW 3 72,848,378 (GRCm39) missense probably damaging 1.00
R0704:Sis UTSW 3 72,857,155 (GRCm39) missense possibly damaging 0.63
R0706:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0710:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0752:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0753:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0754:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0767:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0769:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0772:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0774:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0776:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0818:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0819:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0885:Sis UTSW 3 72,819,282 (GRCm39) nonsense probably null
R1076:Sis UTSW 3 72,841,431 (GRCm39) missense probably damaging 0.97
R1140:Sis UTSW 3 72,858,949 (GRCm39) missense probably damaging 0.98
R1175:Sis UTSW 3 72,865,437 (GRCm39) splice site probably benign
R1437:Sis UTSW 3 72,841,475 (GRCm39) missense probably damaging 1.00
R1466:Sis UTSW 3 72,839,393 (GRCm39) missense possibly damaging 0.60
R1466:Sis UTSW 3 72,839,393 (GRCm39) missense possibly damaging 0.60
R1472:Sis UTSW 3 72,796,360 (GRCm39) missense probably benign 0.12
R1584:Sis UTSW 3 72,839,393 (GRCm39) missense possibly damaging 0.60
R1707:Sis UTSW 3 72,816,420 (GRCm39) splice site probably benign
R1715:Sis UTSW 3 72,796,343 (GRCm39) missense possibly damaging 0.47
R1719:Sis UTSW 3 72,872,937 (GRCm39) missense probably damaging 1.00
R1728:Sis UTSW 3 72,872,978 (GRCm39) nonsense probably null
R1784:Sis UTSW 3 72,872,978 (GRCm39) nonsense probably null
R1820:Sis UTSW 3 72,828,475 (GRCm39) missense probably damaging 1.00
R1972:Sis UTSW 3 72,828,337 (GRCm39) missense probably damaging 1.00
R1973:Sis UTSW 3 72,828,337 (GRCm39) missense probably damaging 1.00
R2054:Sis UTSW 3 72,820,570 (GRCm39) missense probably benign 0.01
R2233:Sis UTSW 3 72,820,527 (GRCm39) missense probably benign 0.03
R2235:Sis UTSW 3 72,820,527 (GRCm39) missense probably benign 0.03
R2276:Sis UTSW 3 72,821,934 (GRCm39) nonsense probably null
R2435:Sis UTSW 3 72,819,237 (GRCm39) missense probably benign 0.01
R2885:Sis UTSW 3 72,816,506 (GRCm39) missense probably benign 0.01
R2966:Sis UTSW 3 72,796,343 (GRCm39) missense probably benign 0.30
R3708:Sis UTSW 3 72,850,856 (GRCm39) missense probably benign 0.02
R3790:Sis UTSW 3 72,828,747 (GRCm39) missense probably damaging 1.00
R3807:Sis UTSW 3 72,832,929 (GRCm39) missense probably benign 0.01
R3858:Sis UTSW 3 72,835,985 (GRCm39) missense probably damaging 0.99
R3974:Sis UTSW 3 72,850,968 (GRCm39) missense probably damaging 0.96
R3975:Sis UTSW 3 72,850,968 (GRCm39) missense probably damaging 0.96
R4037:Sis UTSW 3 72,835,935 (GRCm39) missense probably benign
R4080:Sis UTSW 3 72,828,517 (GRCm39) missense probably damaging 1.00
R4204:Sis UTSW 3 72,868,415 (GRCm39) missense probably benign
R4394:Sis UTSW 3 72,863,482 (GRCm39) missense probably damaging 1.00
R4470:Sis UTSW 3 72,835,492 (GRCm39) splice site probably null
R4573:Sis UTSW 3 72,835,570 (GRCm39) missense possibly damaging 0.94
R4868:Sis UTSW 3 72,850,881 (GRCm39) missense probably benign 0.09
R5023:Sis UTSW 3 72,841,455 (GRCm39) missense probably benign 0.05
R5264:Sis UTSW 3 72,857,089 (GRCm39) missense probably damaging 0.98
R5414:Sis UTSW 3 72,859,826 (GRCm39) missense probably benign
R5462:Sis UTSW 3 72,857,171 (GRCm39) missense probably damaging 0.96
R5523:Sis UTSW 3 72,798,754 (GRCm39) missense probably benign 0.00
R5584:Sis UTSW 3 72,817,748 (GRCm39) missense probably damaging 1.00
R5587:Sis UTSW 3 72,821,909 (GRCm39) missense possibly damaging 0.94
R5725:Sis UTSW 3 72,872,931 (GRCm39) missense probably damaging 1.00
R5769:Sis UTSW 3 72,835,568 (GRCm39) missense probably damaging 0.98
R5790:Sis UTSW 3 72,835,507 (GRCm39) missense probably benign
R5864:Sis UTSW 3 72,857,151 (GRCm39) missense probably damaging 1.00
R5902:Sis UTSW 3 72,867,589 (GRCm39) critical splice donor site probably null
R5925:Sis UTSW 3 72,828,713 (GRCm39) splice site probably null
R6018:Sis UTSW 3 72,820,525 (GRCm39) missense possibly damaging 0.95
R6029:Sis UTSW 3 72,835,641 (GRCm39) missense probably benign 0.30
R6124:Sis UTSW 3 72,860,544 (GRCm39) missense possibly damaging 0.69
R6171:Sis UTSW 3 72,868,360 (GRCm39) missense possibly damaging 0.75
R6182:Sis UTSW 3 72,811,626 (GRCm39) missense probably benign 0.05
R6295:Sis UTSW 3 72,874,103 (GRCm39) missense probably damaging 0.99
R6416:Sis UTSW 3 72,819,187 (GRCm39) missense probably damaging 1.00
R6431:Sis UTSW 3 72,865,507 (GRCm39) missense probably benign 0.00
R6472:Sis UTSW 3 72,846,067 (GRCm39) nonsense probably null
R6517:Sis UTSW 3 72,814,475 (GRCm39) missense probably damaging 1.00
R6701:Sis UTSW 3 72,856,860 (GRCm39) missense probably damaging 1.00
R6796:Sis UTSW 3 72,872,951 (GRCm39) missense probably benign 0.06
R6853:Sis UTSW 3 72,798,759 (GRCm39) missense possibly damaging 0.93
R6906:Sis UTSW 3 72,826,818 (GRCm39) missense probably damaging 1.00
R7058:Sis UTSW 3 72,810,940 (GRCm39) missense probably damaging 0.98
R7357:Sis UTSW 3 72,832,404 (GRCm39) missense probably damaging 1.00
R7381:Sis UTSW 3 72,820,625 (GRCm39) splice site probably null
R7439:Sis UTSW 3 72,816,374 (GRCm39) missense possibly damaging 0.81
R7742:Sis UTSW 3 72,832,431 (GRCm39) missense probably benign 0.19
R7813:Sis UTSW 3 72,832,801 (GRCm39) missense probably benign 0.01
R7883:Sis UTSW 3 72,828,329 (GRCm39) missense possibly damaging 0.78
R7899:Sis UTSW 3 72,844,584 (GRCm39) missense probably damaging 1.00
R7915:Sis UTSW 3 72,828,471 (GRCm39) missense probably damaging 0.99
R7985:Sis UTSW 3 72,844,294 (GRCm39) splice site probably null
R8020:Sis UTSW 3 72,816,298 (GRCm39) critical splice donor site probably null
R8023:Sis UTSW 3 72,859,813 (GRCm39) missense probably damaging 0.97
R8029:Sis UTSW 3 72,828,475 (GRCm39) missense probably damaging 1.00
R8053:Sis UTSW 3 72,856,901 (GRCm39) nonsense probably null
R8062:Sis UTSW 3 72,828,321 (GRCm39) nonsense probably null
R8074:Sis UTSW 3 72,824,531 (GRCm39) missense probably damaging 1.00
R8085:Sis UTSW 3 72,814,462 (GRCm39) missense probably damaging 1.00
R8137:Sis UTSW 3 72,796,378 (GRCm39) missense probably benign 0.22
R8349:Sis UTSW 3 72,810,984 (GRCm39) missense probably damaging 1.00
R8354:Sis UTSW 3 72,854,834 (GRCm39) missense possibly damaging 0.84
R8366:Sis UTSW 3 72,865,566 (GRCm39) missense probably damaging 1.00
R8449:Sis UTSW 3 72,810,984 (GRCm39) missense probably damaging 1.00
R8454:Sis UTSW 3 72,854,834 (GRCm39) missense possibly damaging 0.84
R8474:Sis UTSW 3 72,836,730 (GRCm39) missense probably damaging 1.00
R8515:Sis UTSW 3 72,836,742 (GRCm39) missense probably benign 0.00
R8680:Sis UTSW 3 72,867,628 (GRCm39) missense probably damaging 1.00
R8703:Sis UTSW 3 72,867,657 (GRCm39) missense probably damaging 1.00
R9098:Sis UTSW 3 72,844,578 (GRCm39) missense possibly damaging 0.66
R9466:Sis UTSW 3 72,872,910 (GRCm39) critical splice donor site probably null
R9574:Sis UTSW 3 72,828,490 (GRCm39) missense probably benign 0.05
R9630:Sis UTSW 3 72,828,722 (GRCm39) missense probably benign 0.11
R9680:Sis UTSW 3 72,863,621 (GRCm39) missense probably benign 0.12
R9709:Sis UTSW 3 72,799,074 (GRCm39) missense possibly damaging 0.47
R9731:Sis UTSW 3 72,835,543 (GRCm39) missense probably benign 0.01
X0009:Sis UTSW 3 72,796,355 (GRCm39) missense probably damaging 0.99
X0024:Sis UTSW 3 72,836,003 (GRCm39) missense probably benign
X0060:Sis UTSW 3 72,828,239 (GRCm39) intron probably benign
Z1176:Sis UTSW 3 72,850,890 (GRCm39) missense probably benign 0.25
Z1176:Sis UTSW 3 72,811,606 (GRCm39) missense probably benign 0.05
Z1177:Sis UTSW 3 72,850,902 (GRCm39) missense probably damaging 1.00
Z1177:Sis UTSW 3 72,817,807 (GRCm39) missense probably damaging 1.00
Z1177:Sis UTSW 3 72,816,505 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGCACAAGTAAATATGCCCATGACCA -3'
(R):5'- CTTTCACTCAAGTCTAAAGTGCCTGTCT -3'

Sequencing Primer
(F):5'- TGCCCATGACCATAAGCATATACTG -3'
(R):5'- GTCTAAAGTGCCTGTCTTAatatgtg -3'
Posted On 2014-02-18