Mutagenetix > Incidental Mutations

Incidental Mutation 'R1301:Nup210'

158364

Institutional Source

Beutler Lab

Gene Symbol

Nup210

Ensembl Gene

ENSMUSG00000030091

Gene Name

nucleoporin 210

Synonyms

gp190, Pom210, gp210

MMRRC Submission

039367-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1301 (G1)

Quality Score

210

Status

Validated

Chromosome

Chromosomal Location

91013068-91116829 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 91042347 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 259 (V259M)

Ref Sequence

ENSEMBL: ENSMUSP00000120098 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032179] [ENSMUST00000113509] [ENSMUST00000142951]

Predicted Effect

probably benign
Transcript: ENSMUST00000032179
AA Change: V1046M

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000032179
Gene: ENSMUSG00000030091
AA Change: V1046M

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Blast:BID_2	450	527	3e-29	BLAST
low complexity region	850	862	N/A	INTRINSIC
Blast:S1	937	1022	6e-37	BLAST
BID_2	1077	1152	8.36e-6	SMART
low complexity region	1159	1168	N/A	INTRINSIC
Blast:BID_2	1468	1551	3e-35	BLAST
transmembrane domain	1809	1831	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113509
AA Change: V1002M

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000109137
Gene: ENSMUSG00000030091
AA Change: V1002M

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Blast:BID_2	450	527	4e-29	BLAST
low complexity region	806	818	N/A	INTRINSIC
Blast:S1	893	978	4e-37	BLAST
BID_2	1033	1108	8.36e-6	SMART
low complexity region	1115	1124	N/A	INTRINSIC
Blast:BID_2	1424	1507	3e-35	BLAST
transmembrane domain	1765	1787	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142951
AA Change: V259M

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000120098
Gene: ENSMUSG00000030091
AA Change: V259M

Domain	Start	End	E-Value	Type
low complexity region	63	75	N/A	INTRINSIC
Blast:S1	150	235	3e-37	BLAST
BID_2	290	365	8.36e-6	SMART
low complexity region	372	381	N/A	INTRINSIC
Blast:BID_2	681	764	1e-35	BLAST
transmembrane domain	1022	1044	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.3%
20x: 82.6%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a membrane-spanning glycoprotein that is a major component of the nuclear pore complex. Multiple pseudogenes related to this gene are located on chromosome 3. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano1	A	G	7: 144,633,689	W447R	possibly damaging	Het
Blm	T	A	7: 80,455,417	K103*	probably null	Het
Camta2	A	G	11: 70,676,404	I675T	probably benign	Het
Catsperz	G	A	19: 6,925,082	R15C	probably damaging	Het
Chd1l	T	C	3: 97,603,648		probably benign	Het
Corin	C	A	5: 72,304,933	E844D	possibly damaging	Het
Cyb5rl	T	G	4: 107,080,907	M127R	probably damaging	Het
Dcdc2a	A	T	13: 25,102,586	N164I	possibly damaging	Het
Dnah6	A	G	6: 73,208,545		probably null	Het
Emilin2	T	C	17: 71,255,965		probably benign	Het
Epb41l2	T	A	10: 25,443,902	V211D	probably damaging	Het
Fbxo47	C	T	11: 97,868,601	M166I	probably benign	Het
Gm13124	T	A	4: 144,565,065	I24L	probably benign	Het
Gm4450	G	A	3: 98,446,866	Q106*	probably null	Het
Golm1	T	C	13: 59,638,373	D335G	probably damaging	Het
Gpn1	T	A	5: 31,503,429	M188K	probably damaging	Het
Gpr84	T	A	15: 103,309,219	S144C	probably damaging	Het
Grm8	G	T	6: 27,981,201	Q237K	possibly damaging	Het
Gsdmd	C	A	15: 75,867,059		probably null	Het
Hmgcr	G	A	13: 96,659,020	T347I	probably damaging	Het
Hsd17b7	T	A	1: 169,961,205		probably benign	Het
Klhl7	T	G	5: 24,159,491	W508G	probably damaging	Het
Lrp2	C	A	2: 69,428,604	D4581Y	probably damaging	Het
Lrrc7	T	C	3: 158,135,331	N1357D	probably benign	Het
Macf1	T	C	4: 123,486,658		probably benign	Het
Mroh7	T	C	4: 106,720,495	T329A	probably damaging	Het
Mroh9	C	T	1: 163,043,983		probably null	Het
Mta2	A	G	19: 8,949,186		probably benign	Het
Myo3a	A	T	2: 22,267,095		probably benign	Het
Nrip2	A	G	6: 128,407,389	D153G	probably benign	Het
Nup133	T	C	8: 123,917,417		probably benign	Het
Olfr1338	C	T	4: 118,753,619	M308I	probably benign	Het
Olfr1466	A	T	19: 13,341,847	I30F	probably benign	Het
Olfr1499	A	T	19: 13,815,362	V76D	probably damaging	Het
Otog	C	T	7: 46,289,689	R2048C	probably damaging	Het
Paqr7	T	C	4: 134,507,813	L327P	probably damaging	Het
Parl	A	G	16: 20,286,926	S249P	probably damaging	Het
Phc1	A	G	6: 122,325,874	I230T	probably benign	Het
Pitpnm1	T	G	19: 4,110,831		probably null	Het
Plpp1	A	G	13: 112,834,943	Y48C	probably damaging	Het
Pxdc1	A	G	13: 34,628,887	F194L	probably benign	Het
Rp1	A	T	1: 4,345,936	V1651D	possibly damaging	Het
Serpinb1c	T	A	13: 32,896,960	R47*	probably null	Het
Sis	T	C	3: 72,946,582	T521A	possibly damaging	Het
Slc16a9	A	G	10: 70,282,478	D209G	probably benign	Het
Slc26a4	A	T	12: 31,525,568	C706*	probably null	Het
Slc37a2	A	G	9: 37,236,881	V325A	probably benign	Het
Speg	T	A	1: 75,401,501	D784E	probably damaging	Het
Sycp1	T	C	3: 102,920,622	I270V	probably benign	Het
Tatdn2	T	A	6: 113,704,115	F309I	probably damaging	Het
Tmem206	T	C	1: 191,348,435	V284A	probably damaging	Het
Tmem67	T	C	4: 12,089,400		probably benign	Het
Trpm1	T	A	7: 64,203,053		probably null	Het
Wrn	T	C	8: 33,292,686	R496G	probably damaging	Het
Zfhx2	A	G	14: 55,063,397	V2299A	probably benign	Het
Zfp819	T	A	7: 43,617,100	S260T	possibly damaging	Het

Other mutations in Nup210

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01139:Nup210	APN	6	91030097	missense	possibly damaging	0.92
IGL01532:Nup210	APN	6	91085999	splice site	probably benign
IGL01574:Nup210	APN	6	91040564	missense	probably benign	0.35
IGL01621:Nup210	APN	6	91030117	missense	probably damaging	1.00
IGL01976:Nup210	APN	6	91053614	missense	possibly damaging	0.89
IGL02089:Nup210	APN	6	91076698	missense	probably benign	0.04
IGL02291:Nup210	APN	6	91101268	missense	probably damaging	1.00
IGL03013:Nup210	APN	6	91053379	missense	probably benign	0.00
IGL03046:Nup210	APN	6	91018996	splice site	probably benign
IGL03136:Nup210	APN	6	91028861	missense	probably benign	0.32
IGL03139:Nup210	APN	6	91020239	missense	probably benign	0.08
IGL03195:Nup210	APN	6	91015850	missense	probably benign	0.32
IGL03344:Nup210	APN	6	91021429	missense	possibly damaging	0.53
brotherhood	UTSW	6	91036469	missense	possibly damaging	0.81
equality	UTSW	6	91021395	critical splice donor site	probably null
Liberty	UTSW	6	91020180	missense	probably benign	0.04
unity	UTSW	6	91031668	nonsense	probably null
IGL03134:Nup210	UTSW	6	91030190	missense	probably damaging	0.99
PIT4810001:Nup210	UTSW	6	91030124	missense	probably damaging	1.00
R0100:Nup210	UTSW	6	91069193	missense	probably benign	0.04
R0348:Nup210	UTSW	6	91074310	missense	probably benign	0.27
R0385:Nup210	UTSW	6	91028795	missense	possibly damaging	0.77
R0551:Nup210	UTSW	6	91021484	missense	possibly damaging	0.85
R0606:Nup210	UTSW	6	91026929	missense	possibly damaging	0.89
R1053:Nup210	UTSW	6	91028811	missense	probably benign	0.41
R1381:Nup210	UTSW	6	91075960	missense	probably damaging	0.99
R1464:Nup210	UTSW	6	91053569	missense	possibly damaging	0.82
R1464:Nup210	UTSW	6	91053569	missense	possibly damaging	0.82
R1487:Nup210	UTSW	6	91042576	missense	probably damaging	1.00
R1522:Nup210	UTSW	6	91069166	missense	possibly damaging	0.85
R1529:Nup210	UTSW	6	91036376	missense	probably damaging	1.00
R1531:Nup210	UTSW	6	91034841	missense	probably benign	0.05
R1668:Nup210	UTSW	6	91028805	missense	possibly damaging	0.89
R1694:Nup210	UTSW	6	91062803	missense	probably benign	0.09
R1803:Nup210	UTSW	6	91074282	missense	probably damaging	0.99
R1851:Nup210	UTSW	6	91016054	missense	probably damaging	1.00
R2145:Nup210	UTSW	6	91028876	missense	possibly damaging	0.81
R2196:Nup210	UTSW	6	91055244	missense	probably benign	0.02
R2308:Nup210	UTSW	6	91040868	missense	probably benign	0.19
R2419:Nup210	UTSW	6	91017556	splice site	probably benign
R2912:Nup210	UTSW	6	91026974	missense	probably damaging	1.00
R3413:Nup210	UTSW	6	91025242	missense	probably benign	0.00
R3718:Nup210	UTSW	6	91020180	missense	probably benign	0.04
R3753:Nup210	UTSW	6	91021395	critical splice donor site	probably null
R4058:Nup210	UTSW	6	91060620	missense	probably benign	0.02
R4840:Nup210	UTSW	6	91031668	nonsense	probably null
R4912:Nup210	UTSW	6	91017529	missense	probably benign	0.01
R4967:Nup210	UTSW	6	91036469	missense	possibly damaging	0.81
R4996:Nup210	UTSW	6	91053436	missense	probably benign	0.16
R5074:Nup210	UTSW	6	91055327	missense	probably benign	0.16
R5233:Nup210	UTSW	6	91026969	missense	probably damaging	1.00
R5352:Nup210	UTSW	6	91069316	missense	probably damaging	1.00
R5490:Nup210	UTSW	6	91085988	missense	probably damaging	0.98
R5511:Nup210	UTSW	6	91026963	missense	probably damaging	0.97
R5773:Nup210	UTSW	6	91085883	missense	probably damaging	0.96
R6064:Nup210	UTSW	6	91055291	missense	probably benign	0.01
R6209:Nup210	UTSW	6	91025355	missense	probably benign
R6299:Nup210	UTSW	6	91074288	missense	possibly damaging	0.68
R6705:Nup210	UTSW	6	91087960	missense	possibly damaging	0.50
R6855:Nup210	UTSW	6	91040853	missense	probably benign	0.13
R6856:Nup210	UTSW	6	91087913	nonsense	probably null
R6911:Nup210	UTSW	6	91030130	missense	probably damaging	0.98
R6955:Nup210	UTSW	6	91087927	missense	probably damaging	1.00
R7045:Nup210	UTSW	6	91054451	missense	probably damaging	1.00
R7081:Nup210	UTSW	6	91060665	missense	possibly damaging	0.50
R7163:Nup210	UTSW	6	91073331	missense	probably damaging	1.00
R7305:Nup210	UTSW	6	91087966	missense	probably damaging	1.00
R7387:Nup210	UTSW	6	91021396	critical splice donor site	probably null
R7404:Nup210	UTSW	6	91073245	missense	probably benign	0.01
R7469:Nup210	UTSW	6	91018892	missense	probably benign	0.08
R7603:Nup210	UTSW	6	91076697	missense	probably benign	0.00
R7731:Nup210	UTSW	6	91071888	missense	possibly damaging	0.50
R7822:Nup210	UTSW	6	91018777	missense	possibly damaging	0.71
R7944:Nup210	UTSW	6	91073197	missense	probably damaging	0.99
R8032:Nup210	UTSW	6	91074349	missense	probably benign	0.02
R8039:Nup210	UTSW	6	91070233	missense	probably benign	0.09
R8081:Nup210	UTSW	6	91076675	missense	probably benign	0.00
R8177:Nup210	UTSW	6	91014488	missense	probably benign
R8331:Nup210	UTSW	6	91053666	missense	possibly damaging	0.49
X0067:Nup210	UTSW	6	91074280	missense	probably damaging	1.00
Z1177:Nup210	UTSW	6	91020185	missense	probably benign
Z1177:Nup210	UTSW	6	91087907	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TGGCTTCTCCTTGTGGTTGAAATCC -3'
(R):5'- ATCACTGAGAGACTACCTGAGCCTG -3'

Sequencing Primer
(F):5'- GGTTGAAATCCTAGCCTGTCAC -3'
(R):5'- GTGTTGGACTTCTACAAGAAGCC -3'

Posted On

2014-02-18