Incidental Mutation 'R1301:Zfp819'
ID158368
Institutional Source Beutler Lab
Gene Symbol Zfp819
Ensembl Gene ENSMUSG00000055102
Gene Namezinc finger protein 819
Synonyms4933405K07Rik, 4930427I11Rik
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R1301 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43607169-43618285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43617100 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 260 (S260T)
Ref Sequence ENSEMBL: ENSMUSP00000113867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032661] [ENSMUST00000116324] [ENSMUST00000120935] [ENSMUST00000127765]
Predicted Effect probably benign
Transcript: ENSMUST00000032661
AA Change: S336T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032661
Gene: ENSMUSG00000055102
AA Change: S336T

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116324
AA Change: S336T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112026
Gene: ENSMUSG00000055102
AA Change: S336T

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120935
AA Change: S260T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113867
Gene: ENSMUSG00000055102
AA Change: S260T

DomainStartEndE-ValueType
ZnF_C2H2 224 251 5.4e1 SMART
ZnF_C2H2 280 302 3.74e-5 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 7.78e-3 SMART
ZnF_C2H2 392 414 5.9e-3 SMART
ZnF_C2H2 420 442 1.2e-3 SMART
ZnF_C2H2 448 470 4.79e-3 SMART
ZnF_C2H2 476 498 4.54e-4 SMART
ZnF_C2H2 504 526 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127765
SMART Domains Protein: ENSMUSP00000116658
Gene: ENSMUSG00000055102

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Other mutations in Zfp819
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zfp819 APN 7 43611979 splice site probably benign
IGL01732:Zfp819 APN 7 43616422 missense probably benign 0.13
IGL02139:Zfp819 APN 7 43612110 critical splice donor site probably null
IGL02276:Zfp819 APN 7 43612004 missense possibly damaging 0.84
R0306:Zfp819 UTSW 7 43617197 missense possibly damaging 0.92
R0620:Zfp819 UTSW 7 43616444 missense probably benign 0.07
R1314:Zfp819 UTSW 7 43617056 missense probably benign 0.27
R1980:Zfp819 UTSW 7 43616461 missense probably benign
R4545:Zfp819 UTSW 7 43617785 missense probably damaging 0.98
R4993:Zfp819 UTSW 7 43617296 missense probably benign 0.37
R5053:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R6080:Zfp819 UTSW 7 43616696 missense probably benign 0.00
R7289:Zfp819 UTSW 7 43617082 missense probably damaging 1.00
R7387:Zfp819 UTSW 7 43612641 critical splice donor site probably null
R7608:Zfp819 UTSW 7 43616933 missense probably benign
R7813:Zfp819 UTSW 7 43616767 missense probably benign
R7863:Zfp819 UTSW 7 43617892 missense probably benign 0.17
R8026:Zfp819 UTSW 7 43617895 missense probably benign 0.44
R8080:Zfp819 UTSW 7 43617724 missense probably damaging 1.00
Z1176:Zfp819 UTSW 7 43617687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGTCAGCAGCAAACAACTAACCC -3'
(R):5'- GCATAGACAAACAATTTCCCGCAGTG -3'

Sequencing Primer
(F):5'- CCACATATGTGGGAAATCCTTCC -3'
(R):5'- CCCAGTGTGGATTCTCCGATG -3'
Posted On2014-02-18