Incidental Mutation 'R1301:Zfp819'
ID 158368
Institutional Source Beutler Lab
Gene Symbol Zfp819
Ensembl Gene ENSMUSG00000055102
Gene Name zinc finger protein 819
Synonyms 4933405K07Rik, 4930427I11Rik
MMRRC Submission 039367-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R1301 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 43256593-43267709 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43266524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 260 (S260T)
Ref Sequence ENSEMBL: ENSMUSP00000113867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032661] [ENSMUST00000116324] [ENSMUST00000120935] [ENSMUST00000127765]
AlphaFold Q80V81
Predicted Effect probably benign
Transcript: ENSMUST00000032661
AA Change: S336T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032661
Gene: ENSMUSG00000055102
AA Change: S336T

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116324
AA Change: S336T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112026
Gene: ENSMUSG00000055102
AA Change: S336T

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120935
AA Change: S260T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113867
Gene: ENSMUSG00000055102
AA Change: S260T

DomainStartEndE-ValueType
ZnF_C2H2 224 251 5.4e1 SMART
ZnF_C2H2 280 302 3.74e-5 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 7.78e-3 SMART
ZnF_C2H2 392 414 5.9e-3 SMART
ZnF_C2H2 420 442 1.2e-3 SMART
ZnF_C2H2 448 470 4.79e-3 SMART
ZnF_C2H2 476 498 4.54e-4 SMART
ZnF_C2H2 504 526 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127765
SMART Domains Protein: ENSMUSP00000116658
Gene: ENSMUSG00000055102

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm2 T A 4: 144,291,635 (GRCm39) I24L probably benign Het
Ano1 A G 7: 144,187,426 (GRCm39) W447R possibly damaging Het
Blm T A 7: 80,105,165 (GRCm39) K103* probably null Het
Camta2 A G 11: 70,567,230 (GRCm39) I675T probably benign Het
Catsperz G A 19: 6,902,450 (GRCm39) R15C probably damaging Het
Chd1l T C 3: 97,510,964 (GRCm39) probably benign Het
Corin C A 5: 72,462,276 (GRCm39) E844D possibly damaging Het
Cyb5rl T G 4: 106,938,104 (GRCm39) M127R probably damaging Het
Dcdc2a A T 13: 25,286,569 (GRCm39) N164I possibly damaging Het
Dnah6 A G 6: 73,185,528 (GRCm39) probably null Het
Emilin2 T C 17: 71,562,960 (GRCm39) probably benign Het
Epb41l2 T A 10: 25,319,800 (GRCm39) V211D probably damaging Het
Fbxo47 C T 11: 97,759,427 (GRCm39) M166I probably benign Het
Golm1 T C 13: 59,786,187 (GRCm39) D335G probably damaging Het
Gpn1 T A 5: 31,660,773 (GRCm39) M188K probably damaging Het
Gpr84 T A 15: 103,217,646 (GRCm39) S144C probably damaging Het
Grm8 G T 6: 27,981,200 (GRCm39) Q237K possibly damaging Het
Gsdmd C A 15: 75,738,908 (GRCm39) probably null Het
Hmgcr G A 13: 96,795,528 (GRCm39) T347I probably damaging Het
Hsd17b7 T A 1: 169,788,774 (GRCm39) probably benign Het
Hsd3b9 G A 3: 98,354,182 (GRCm39) Q106* probably null Het
Klhl7 T G 5: 24,364,489 (GRCm39) W508G probably damaging Het
Lrp2 C A 2: 69,258,948 (GRCm39) D4581Y probably damaging Het
Lrrc7 T C 3: 157,840,968 (GRCm39) N1357D probably benign Het
Macf1 T C 4: 123,380,451 (GRCm39) probably benign Het
Mroh7 T C 4: 106,577,692 (GRCm39) T329A probably damaging Het
Mroh9 C T 1: 162,871,552 (GRCm39) probably null Het
Mta2 A G 19: 8,926,550 (GRCm39) probably benign Het
Myo3a A T 2: 22,271,906 (GRCm39) probably benign Het
Nrip2 A G 6: 128,384,352 (GRCm39) D153G probably benign Het
Nup133 T C 8: 124,644,156 (GRCm39) probably benign Het
Nup210 C T 6: 91,019,329 (GRCm39) V259M possibly damaging Het
Or10ak14 C T 4: 118,610,816 (GRCm39) M308I probably benign Het
Or5b112 A T 19: 13,319,211 (GRCm39) I30F probably benign Het
Or9i14 A T 19: 13,792,726 (GRCm39) V76D probably damaging Het
Otog C T 7: 45,939,113 (GRCm39) R2048C probably damaging Het
Pacc1 T C 1: 191,080,632 (GRCm39) V284A probably damaging Het
Paqr7 T C 4: 134,235,124 (GRCm39) L327P probably damaging Het
Parl A G 16: 20,105,676 (GRCm39) S249P probably damaging Het
Phc1 A G 6: 122,302,833 (GRCm39) I230T probably benign Het
Pitpnm1 T G 19: 4,160,831 (GRCm39) probably null Het
Plpp1 A G 13: 112,971,477 (GRCm39) Y48C probably damaging Het
Pxdc1 A G 13: 34,812,870 (GRCm39) F194L probably benign Het
Rp1 A T 1: 4,416,159 (GRCm39) V1651D possibly damaging Het
Serpinb1c T A 13: 33,080,943 (GRCm39) R47* probably null Het
Sis T C 3: 72,853,915 (GRCm39) T521A possibly damaging Het
Slc16a9 A G 10: 70,118,308 (GRCm39) D209G probably benign Het
Slc26a4 A T 12: 31,575,567 (GRCm39) C706* probably null Het
Slc37a2 A G 9: 37,148,177 (GRCm39) V325A probably benign Het
Speg T A 1: 75,378,145 (GRCm39) D784E probably damaging Het
Sycp1 T C 3: 102,827,938 (GRCm39) I270V probably benign Het
Tatdn2 T A 6: 113,681,076 (GRCm39) F309I probably damaging Het
Tmem67 T C 4: 12,089,400 (GRCm39) probably benign Het
Trpm1 T A 7: 63,852,801 (GRCm39) probably null Het
Wrn T C 8: 33,782,714 (GRCm39) R496G probably damaging Het
Zfhx2 A G 14: 55,300,854 (GRCm39) V2299A probably benign Het
Other mutations in Zfp819
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zfp819 APN 7 43,261,403 (GRCm39) splice site probably benign
IGL01732:Zfp819 APN 7 43,265,846 (GRCm39) missense probably benign 0.13
IGL02139:Zfp819 APN 7 43,261,534 (GRCm39) critical splice donor site probably null
IGL02276:Zfp819 APN 7 43,261,428 (GRCm39) missense possibly damaging 0.84
R0306:Zfp819 UTSW 7 43,266,621 (GRCm39) missense possibly damaging 0.92
R0620:Zfp819 UTSW 7 43,265,868 (GRCm39) missense probably benign 0.07
R1314:Zfp819 UTSW 7 43,266,480 (GRCm39) missense probably benign 0.27
R1980:Zfp819 UTSW 7 43,265,885 (GRCm39) missense probably benign
R4545:Zfp819 UTSW 7 43,267,209 (GRCm39) missense probably damaging 0.98
R4993:Zfp819 UTSW 7 43,266,720 (GRCm39) missense probably benign 0.37
R5053:Zfp819 UTSW 7 43,266,570 (GRCm39) missense probably damaging 1.00
R6080:Zfp819 UTSW 7 43,266,120 (GRCm39) missense probably benign 0.00
R7289:Zfp819 UTSW 7 43,266,506 (GRCm39) missense probably damaging 1.00
R7387:Zfp819 UTSW 7 43,262,065 (GRCm39) critical splice donor site probably null
R7608:Zfp819 UTSW 7 43,266,357 (GRCm39) missense probably benign
R7813:Zfp819 UTSW 7 43,266,191 (GRCm39) missense probably benign
R7863:Zfp819 UTSW 7 43,267,316 (GRCm39) missense probably benign 0.17
R8026:Zfp819 UTSW 7 43,267,319 (GRCm39) missense probably benign 0.44
R8080:Zfp819 UTSW 7 43,267,148 (GRCm39) missense probably damaging 1.00
R9072:Zfp819 UTSW 7 43,266,570 (GRCm39) missense probably damaging 1.00
R9073:Zfp819 UTSW 7 43,266,570 (GRCm39) missense probably damaging 1.00
R9199:Zfp819 UTSW 7 43,267,203 (GRCm39) missense probably benign 0.04
R9792:Zfp819 UTSW 7 43,261,519 (GRCm39) missense possibly damaging 0.93
Z1176:Zfp819 UTSW 7 43,267,111 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGTCAGCAGCAAACAACTAACCC -3'
(R):5'- GCATAGACAAACAATTTCCCGCAGTG -3'

Sequencing Primer
(F):5'- CCACATATGTGGGAAATCCTTCC -3'
(R):5'- CCCAGTGTGGATTCTCCGATG -3'
Posted On 2014-02-18