Incidental Mutation 'R1301:Otog'
ID158369
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Nameotogelin
SynonymsOtgn
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.771) question?
Stock #R1301 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46240987-46311434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46289689 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 2048 (R2048C)
Ref Sequence ENSEMBL: ENSMUSP00000130949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538]
Predicted Effect probably damaging
Transcript: ENSMUST00000164538
AA Change: R2048C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: R2048C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 46251282 missense probably damaging 1.00
IGL00725:Otog APN 7 46274092 missense probably damaging 1.00
IGL00757:Otog APN 7 46290128 missense probably damaging 1.00
IGL00822:Otog APN 7 46295880 missense probably benign 0.24
IGL01354:Otog APN 7 46289726 missense probably damaging 1.00
IGL01567:Otog APN 7 46276615 splice site probably benign
IGL02034:Otog APN 7 46295993 nonsense probably null
IGL02090:Otog APN 7 46300147 missense probably damaging 1.00
IGL02132:Otog APN 7 46305479 missense probably damaging 0.99
IGL02148:Otog APN 7 46300587 missense probably damaging 1.00
IGL02173:Otog APN 7 46276741 splice site probably benign
IGL02199:Otog APN 7 46277351 missense possibly damaging 0.90
IGL02216:Otog APN 7 46301468 missense probably damaging 1.00
IGL02322:Otog APN 7 46301457 missense probably benign 0.01
IGL02330:Otog APN 7 46288069 missense possibly damaging 0.84
IGL02529:Otog APN 7 46259957 missense probably damaging 0.99
IGL02898:Otog APN 7 46310138 missense probably damaging 1.00
IGL02970:Otog APN 7 46295867 missense probably benign 0.11
IGL03085:Otog APN 7 46305922 critical splice donor site probably null
IGL03108:Otog APN 7 46251338 missense probably damaging 1.00
IGL03275:Otog APN 7 46306230 missense probably damaging 1.00
I1329:Otog UTSW 7 46246503 missense probably benign 0.02
IGL02984:Otog UTSW 7 46305508 missense probably damaging 0.98
PIT4472001:Otog UTSW 7 46295849 missense probably damaging 1.00
R0032:Otog UTSW 7 46288213 nonsense probably null
R0032:Otog UTSW 7 46304231 missense probably damaging 0.97
R0105:Otog UTSW 7 46288366 missense possibly damaging 0.79
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0165:Otog UTSW 7 46304231 missense probably damaging 0.97
R0166:Otog UTSW 7 46304231 missense probably damaging 0.97
R0167:Otog UTSW 7 46304231 missense probably damaging 0.97
R0240:Otog UTSW 7 46264032 splice site probably null
R0240:Otog UTSW 7 46264032 splice site probably null
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0282:Otog UTSW 7 46277493 missense possibly damaging 0.93
R0392:Otog UTSW 7 46250075 missense probably benign 0.00
R0436:Otog UTSW 7 46265936 splice site probably benign
R0441:Otog UTSW 7 46305877 missense probably damaging 1.00
R0499:Otog UTSW 7 46273832 missense probably damaging 1.00
R0530:Otog UTSW 7 46298244 missense probably damaging 0.98
R0541:Otog UTSW 7 46269249 splice site probably benign
R0600:Otog UTSW 7 46251395 splice site probably benign
R0626:Otog UTSW 7 46271373 missense possibly damaging 0.95
R0636:Otog UTSW 7 46264228 critical splice donor site probably null
R0764:Otog UTSW 7 46300494 missense probably benign 0.00
R0833:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0836:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0844:Otog UTSW 7 46287828 missense possibly damaging 0.53
R1029:Otog UTSW 7 46274595 missense probably damaging 1.00
R1116:Otog UTSW 7 46300601 splice site probably benign
R1134:Otog UTSW 7 46298514 missense probably damaging 1.00
R1183:Otog UTSW 7 46289755 missense probably benign 0.41
R1204:Otog UTSW 7 46259911 missense probably benign 0.16
R1344:Otog UTSW 7 46274615 missense probably damaging 1.00
R1384:Otog UTSW 7 46273695 splice site probably benign
R1418:Otog UTSW 7 46274615 missense probably damaging 1.00
R1432:Otog UTSW 7 46300583 missense probably damaging 1.00
R1479:Otog UTSW 7 46295978 missense possibly damaging 0.75
R1521:Otog UTSW 7 46259264 missense possibly damaging 0.71
R1589:Otog UTSW 7 46283908 missense probably benign 0.18
R1671:Otog UTSW 7 46261786 missense probably damaging 1.00
R1773:Otog UTSW 7 46288159 missense probably benign 0.28
R1806:Otog UTSW 7 46290937 critical splice acceptor site probably null
R1843:Otog UTSW 7 46246283 missense probably damaging 1.00
R1873:Otog UTSW 7 46269343 missense probably damaging 1.00
R1923:Otog UTSW 7 46246283 missense probably damaging 1.00
R1927:Otog UTSW 7 46246283 missense probably damaging 1.00
R2008:Otog UTSW 7 46264074 missense probably benign 0.43
R2048:Otog UTSW 7 46287639 missense probably damaging 1.00
R2131:Otog UTSW 7 46250100 missense probably damaging 1.00
R2153:Otog UTSW 7 46302904 missense probably damaging 1.00
R2240:Otog UTSW 7 46241029 start codon destroyed probably null
R2278:Otog UTSW 7 46300044 missense probably damaging 1.00
R2407:Otog UTSW 7 46241540 missense probably benign 0.10
R2424:Otog UTSW 7 46298169 nonsense probably null
R2513:Otog UTSW 7 46305590 critical splice donor site probably null
R2863:Otog UTSW 7 46269306 missense probably damaging 1.00
R3148:Otog UTSW 7 46290169 missense probably damaging 1.00
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3733:Otog UTSW 7 46288368 missense probably benign 0.03
R3734:Otog UTSW 7 46288368 missense probably benign 0.03
R3855:Otog UTSW 7 46273760 missense possibly damaging 0.65
R3880:Otog UTSW 7 46288021 missense possibly damaging 0.93
R4081:Otog UTSW 7 46288299 missense possibly damaging 0.92
R4349:Otog UTSW 7 46274189 missense probably damaging 0.99
R4382:Otog UTSW 7 46289698 missense probably damaging 1.00
R4392:Otog UTSW 7 46285124 missense probably damaging 0.98
R4520:Otog UTSW 7 46241053 unclassified probably benign
R4569:Otog UTSW 7 46310147 missense probably damaging 1.00
R4580:Otog UTSW 7 46287801 missense possibly damaging 0.78
R4672:Otog UTSW 7 46289786 missense probably damaging 0.98
R4764:Otog UTSW 7 46288519 missense probably benign 0.29
R4910:Otog UTSW 7 46264062 missense probably damaging 1.00
R4910:Otog UTSW 7 46298534 missense probably damaging 1.00
R4913:Otog UTSW 7 46264102 missense probably benign 0.31
R4975:Otog UTSW 7 46287991 missense probably benign 0.00
R4996:Otog UTSW 7 46298606 missense possibly damaging 0.51
R4996:Otog UTSW 7 46305510 nonsense probably null
R5116:Otog UTSW 7 46273767 missense probably benign 0.34
R5138:Otog UTSW 7 46250006 missense possibly damaging 0.61
R5169:Otog UTSW 7 46298148 missense probably benign 0.06
R5239:Otog UTSW 7 46287435 missense probably benign 0.15
R5277:Otog UTSW 7 46246621 missense possibly damaging 0.89
R5287:Otog UTSW 7 46269329 missense probably damaging 0.98
R5299:Otog UTSW 7 46288851 missense probably benign 0.16
R5378:Otog UTSW 7 46255004 missense probably damaging 1.00
R5382:Otog UTSW 7 46249004 missense probably damaging 1.00
R5487:Otog UTSW 7 46288768 missense probably benign 0.27
R5507:Otog UTSW 7 46261699 missense probably damaging 1.00
R5517:Otog UTSW 7 46274571 missense probably damaging 1.00
R5643:Otog UTSW 7 46287447 missense probably damaging 1.00
R5757:Otog UTSW 7 46241121 critical splice donor site probably null
R5910:Otog UTSW 7 46298598 missense possibly damaging 0.94
R6019:Otog UTSW 7 46288950 missense probably benign 0.00
R6150:Otog UTSW 7 46264059 missense possibly damaging 0.82
R6225:Otog UTSW 7 46249034 missense possibly damaging 0.67
R6271:Otog UTSW 7 46252040 missense probably damaging 1.00
R6317:Otog UTSW 7 46301215 missense probably damaging 1.00
R6454:Otog UTSW 7 46305817 missense probably damaging 1.00
R6640:Otog UTSW 7 46261743 missense possibly damaging 0.92
R6753:Otog UTSW 7 46249071 missense probably benign 0.06
R6788:Otog UTSW 7 46298317 missense probably damaging 1.00
R6859:Otog UTSW 7 46273781 missense probably damaging 0.96
R7033:Otog UTSW 7 46267398 critical splice donor site probably null
R7071:Otog UTSW 7 46267323 missense probably damaging 1.00
R7084:Otog UTSW 7 46298566 nonsense probably null
R7116:Otog UTSW 7 46298265 missense probably damaging 0.99
R7202:Otog UTSW 7 46288050 missense probably damaging 0.97
R7365:Otog UTSW 7 46298308 missense probably damaging 1.00
R7468:Otog UTSW 7 46264119 missense probably benign
R7475:Otog UTSW 7 46267276 missense probably damaging 0.99
R7502:Otog UTSW 7 46298615 missense probably damaging 1.00
R7558:Otog UTSW 7 46303160 missense probably damaging 0.99
X0062:Otog UTSW 7 46259921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGAGCTTTGGACCGTGAGAATG -3'
(R):5'- TTTGTCAGGGCAGGAGTCACAGTG -3'

Sequencing Primer
(F):5'- catcaattaaaacaacccaccac -3'
(R):5'- AAAAGACACAGAGGCTCTGACTG -3'
Posted On2014-02-18