Mutagenetix > Incidental Mutation

Incidental Mutation 'R1301:Trpm1'

158370

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

039367-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1301 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 64203053 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205690] [ENSMUST00000205731] [ENSMUST00000206049] [ENSMUST00000206277] [ENSMUST00000206263] [ENSMUST00000206706] [ENSMUST00000206314] [ENSMUST00000206107]

AlphaFold

Q2TV84

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083651

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085222
AA Change: S205T

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: S205T

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107525
AA Change: S205T

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: S205T

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
Pfam:Ion_trans	876	1138	7.6e-22	PFAM
transmembrane domain	1156	1173	N/A	INTRINSIC
Pfam:TRPM_tetra	1230	1285	9.4e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177102
AA Change: S89T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: S89T

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000205348
AA Change: S205T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205434

Predicted Effect

probably null
Transcript: ENSMUST00000205684

Predicted Effect

probably null
Transcript: ENSMUST00000205684

Predicted Effect

probably benign
Transcript: ENSMUST00000205690

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205728

Predicted Effect

probably benign
Transcript: ENSMUST00000205731
AA Change: S89T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205960

Predicted Effect

probably benign
Transcript: ENSMUST00000206049

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206277
AA Change: S205T

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206263
AA Change: S89T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000206706
AA Change: S72T

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206473

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206453

Predicted Effect

probably benign
Transcript: ENSMUST00000206107

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.3%
20x: 82.6%

Validation Efficiency

96% (67/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano1	A	G	7: 144,633,689	W447R	possibly damaging	Het
Blm	T	A	7: 80,455,417	K103*	probably null	Het
Camta2	A	G	11: 70,676,404	I675T	probably benign	Het
Catsperz	G	A	19: 6,925,082	R15C	probably damaging	Het
Chd1l	T	C	3: 97,603,648		probably benign	Het
Corin	C	A	5: 72,304,933	E844D	possibly damaging	Het
Cyb5rl	T	G	4: 107,080,907	M127R	probably damaging	Het
Dcdc2a	A	T	13: 25,102,586	N164I	possibly damaging	Het
Dnah6	A	G	6: 73,208,545		probably null	Het
Emilin2	T	C	17: 71,255,965		probably benign	Het
Epb41l2	T	A	10: 25,443,902	V211D	probably damaging	Het
Fbxo47	C	T	11: 97,868,601	M166I	probably benign	Het
Gm13124	T	A	4: 144,565,065	I24L	probably benign	Het
Gm4450	G	A	3: 98,446,866	Q106*	probably null	Het
Golm1	T	C	13: 59,638,373	D335G	probably damaging	Het
Gpn1	T	A	5: 31,503,429	M188K	probably damaging	Het
Gpr84	T	A	15: 103,309,219	S144C	probably damaging	Het
Grm8	G	T	6: 27,981,201	Q237K	possibly damaging	Het
Gsdmd	C	A	15: 75,867,059		probably null	Het
Hmgcr	G	A	13: 96,659,020	T347I	probably damaging	Het
Hsd17b7	T	A	1: 169,961,205		probably benign	Het
Klhl7	T	G	5: 24,159,491	W508G	probably damaging	Het
Lrp2	C	A	2: 69,428,604	D4581Y	probably damaging	Het
Lrrc7	T	C	3: 158,135,331	N1357D	probably benign	Het
Macf1	T	C	4: 123,486,658		probably benign	Het
Mroh7	T	C	4: 106,720,495	T329A	probably damaging	Het
Mroh9	C	T	1: 163,043,983		probably null	Het
Mta2	A	G	19: 8,949,186		probably benign	Het
Myo3a	A	T	2: 22,267,095		probably benign	Het
Nrip2	A	G	6: 128,407,389	D153G	probably benign	Het
Nup133	T	C	8: 123,917,417		probably benign	Het
Nup210	C	T	6: 91,042,347	V259M	possibly damaging	Het
Olfr1338	C	T	4: 118,753,619	M308I	probably benign	Het
Olfr1466	A	T	19: 13,341,847	I30F	probably benign	Het
Olfr1499	A	T	19: 13,815,362	V76D	probably damaging	Het
Otog	C	T	7: 46,289,689	R2048C	probably damaging	Het
Paqr7	T	C	4: 134,507,813	L327P	probably damaging	Het
Parl	A	G	16: 20,286,926	S249P	probably damaging	Het
Phc1	A	G	6: 122,325,874	I230T	probably benign	Het
Pitpnm1	T	G	19: 4,110,831		probably null	Het
Plpp1	A	G	13: 112,834,943	Y48C	probably damaging	Het
Pxdc1	A	G	13: 34,628,887	F194L	probably benign	Het
Rp1	A	T	1: 4,345,936	V1651D	possibly damaging	Het
Serpinb1c	T	A	13: 32,896,960	R47*	probably null	Het
Sis	T	C	3: 72,946,582	T521A	possibly damaging	Het
Slc16a9	A	G	10: 70,282,478	D209G	probably benign	Het
Slc26a4	A	T	12: 31,525,568	C706*	probably null	Het
Slc37a2	A	G	9: 37,236,881	V325A	probably benign	Het
Speg	T	A	1: 75,401,501	D784E	probably damaging	Het
Sycp1	T	C	3: 102,920,622	I270V	probably benign	Het
Tatdn2	T	A	6: 113,704,115	F309I	probably damaging	Het
Tmem206	T	C	1: 191,348,435	V284A	probably damaging	Het
Tmem67	T	C	4: 12,089,400		probably benign	Het
Wrn	T	C	8: 33,292,686	R496G	probably damaging	Het
Zfhx2	A	G	14: 55,063,397	V2299A	probably benign	Het
Zfp819	T	A	7: 43,617,100	S260T	possibly damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGAAGGTTCCATCCCTGATCCACAG -3'
(R):5'- GGAAGCCATAGCAATCTGAGTGTCC -3'

Sequencing Primer
(F):5'- CCCTGATCCACAGGGATTATG -3'
(R):5'- aggaggaaggagagatggg -3'

Posted On

2014-02-18