Incidental Mutation 'R1301:Ano1'
ID 158372
Institutional Source Beutler Lab
Gene Symbol Ano1
Ensembl Gene ENSMUSG00000031075
Gene Name anoctamin 1, calcium activated chloride channel
Synonyms Tmem16a
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1301 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 144588549-144751974 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144633689 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 447 (W447R)
Ref Sequence ENSEMBL: ENSMUSP00000113899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033393
AA Change: W389R

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: W389R

DomainStartEndE-ValueType
low complexity region 129 147 N/A INTRINSIC
Pfam:Anoctamin 320 898 1.3e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118556
AA Change: W447R

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: W447R

DomainStartEndE-ValueType
Pfam:Anoct_dimer 112 375 5.5e-83 PFAM
Pfam:Anoctamin 378 955 6.7e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121758
AA Change: W446R

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: W446R

DomainStartEndE-ValueType
Pfam:Anoct_dimer 54 317 7.1e-83 PFAM
Pfam:Anoctamin 320 901 2.2e-139 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152531
AA Change: W276R
SMART Domains Protein: ENSMUSP00000119653
Gene: ENSMUSG00000031075
AA Change: W276R

DomainStartEndE-ValueType
Pfam:Anoct_dimer 2 205 4.4e-64 PFAM
Pfam:Anoctamin 208 335 3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208985
Meta Mutation Damage Score 0.8848 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Ano1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ano1 APN 7 144638513 missense probably damaging 1.00
IGL00754:Ano1 APN 7 144597231 missense probably damaging 0.98
IGL00780:Ano1 APN 7 144655630 missense probably damaging 0.99
IGL00918:Ano1 APN 7 144644752 splice site probably benign
IGL01112:Ano1 APN 7 144637145 missense possibly damaging 0.52
IGL01285:Ano1 APN 7 144644742 missense probably benign 0.00
IGL01285:Ano1 APN 7 144595538 missense probably damaging 0.98
IGL01308:Ano1 APN 7 144595498 missense probably damaging 0.99
IGL01407:Ano1 APN 7 144637111 missense probably benign 0.22
IGL01672:Ano1 APN 7 144655675 missense probably damaging 0.96
IGL01920:Ano1 APN 7 144611454 splice site probably benign
IGL01926:Ano1 APN 7 144610875 missense possibly damaging 0.94
IGL02164:Ano1 APN 7 144637181 missense possibly damaging 0.91
IGL02190:Ano1 APN 7 144618883 missense probably benign 0.41
IGL02214:Ano1 APN 7 144655708 missense possibly damaging 0.80
IGL02299:Ano1 APN 7 144590075 missense possibly damaging 0.80
IGL02567:Ano1 APN 7 144611625 missense probably damaging 1.00
IGL03131:Ano1 APN 7 144603585 missense possibly damaging 0.90
IGL03291:Ano1 APN 7 144621675 missense probably damaging 1.00
IGL03299:Ano1 APN 7 144654256 missense probably damaging 1.00
IGL03394:Ano1 APN 7 144595439 splice site probably null
PIT4434001:Ano1 UTSW 7 144610895 missense probably benign 0.28
R0502:Ano1 UTSW 7 144597215 missense probably damaging 1.00
R0595:Ano1 UTSW 7 144590153 missense possibly damaging 0.94
R0732:Ano1 UTSW 7 144619488 critical splice acceptor site probably null
R0970:Ano1 UTSW 7 144595571 missense probably benign 0.02
R0988:Ano1 UTSW 7 144633653 missense possibly damaging 0.94
R1074:Ano1 UTSW 7 144611680 missense probably damaging 0.98
R1528:Ano1 UTSW 7 144595566 missense probably damaging 1.00
R2018:Ano1 UTSW 7 144654250 missense probably damaging 1.00
R2056:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2057:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2058:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2059:Ano1 UTSW 7 144611390 missense probably damaging 1.00
R2860:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R2861:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R3770:Ano1 UTSW 7 144595569 missense probably damaging 1.00
R3970:Ano1 UTSW 7 144607963 missense probably benign 0.00
R4179:Ano1 UTSW 7 144650505 missense probably damaging 1.00
R4489:Ano1 UTSW 7 144611742 missense probably benign 0.00
R4678:Ano1 UTSW 7 144669552 missense probably benign 0.01
R4915:Ano1 UTSW 7 144611375 missense possibly damaging 0.69
R5114:Ano1 UTSW 7 144657083 missense possibly damaging 0.71
R5362:Ano1 UTSW 7 144648600 unclassified probably benign
R5364:Ano1 UTSW 7 144637204 missense probably damaging 1.00
R5366:Ano1 UTSW 7 144654209 missense possibly damaging 0.85
R5387:Ano1 UTSW 7 144648619 missense probably benign
R5762:Ano1 UTSW 7 144648037 missense probably damaging 0.99
R5857:Ano1 UTSW 7 144637103 missense probably benign 0.02
R6091:Ano1 UTSW 7 144669434 missense probably benign 0.12
R6093:Ano1 UTSW 7 144611377 missense possibly damaging 0.72
R6177:Ano1 UTSW 7 144678741 missense possibly damaging 0.79
R6246:Ano1 UTSW 7 144633725 missense possibly damaging 0.82
R6274:Ano1 UTSW 7 144618863 missense probably benign 0.01
R6323:Ano1 UTSW 7 144611686 missense possibly damaging 0.95
R6574:Ano1 UTSW 7 144607916 critical splice donor site probably null
R6782:Ano1 UTSW 7 144621687 missense probably damaging 1.00
R6880:Ano1 UTSW 7 144644742 missense probably benign 0.00
R6909:Ano1 UTSW 7 144655731 missense probably damaging 0.96
R7066:Ano1 UTSW 7 144637086 missense probably benign 0.35
R7073:Ano1 UTSW 7 144638552 missense probably damaging 0.96
R7146:Ano1 UTSW 7 144655656 missense probably benign 0.00
R7420:Ano1 UTSW 7 144655641 missense probably benign 0.00
R7874:Ano1 UTSW 7 144621724 missense probably damaging 1.00
R8468:Ano1 UTSW 7 144655620 missense probably damaging 1.00
R8867:Ano1 UTSW 7 144669660 missense possibly damaging 0.66
R8923:Ano1 UTSW 7 144650551 missense possibly damaging 0.61
R9215:Ano1 UTSW 7 144595605 missense probably damaging 1.00
R9281:Ano1 UTSW 7 144595581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCATCTGGGATTCAGTGCAGAC -3'
(R):5'- ATACACCTATGACTGCCAGGGACG -3'

Sequencing Primer
(F):5'- GGCCATCAGGTACACTATGTGAC -3'
(R):5'- GGACGCCCTCCATTGAC -3'
Posted On 2014-02-18