Incidental Mutation 'R1301:Wrn'
ID 158373
Institutional Source Beutler Lab
Gene Symbol Wrn
Ensembl Gene ENSMUSG00000031583
Gene Name Werner syndrome RecQ like helicase
Synonyms
MMRRC Submission 039367-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.301) question?
Stock # R1301 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 33724412-33875555 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33782714 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 496 (R496G)
Ref Sequence ENSEMBL: ENSMUSP00000147379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991] [ENSMUST00000211498]
AlphaFold O09053
Predicted Effect probably damaging
Transcript: ENSMUST00000033990
AA Change: R739G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583
AA Change: R739G

DomainStartEndE-ValueType
35EXOc 47 226 1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.3e-28 SMART
HELICc 743 824 3.7e-27 SMART
RQC 923 1028 3.1e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1222 1318 2.7e-9 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000033991
AA Change: R739G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583
AA Change: R739G

DomainStartEndE-ValueType
35EXOc 47 226 1.1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.4e-28 SMART
HELICc 743 824 3.7e-27 SMART
Pfam:RecQ_Zn_bind 835 905 2.2e-8 PFAM
RQC 923 1028 3.2e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1223 1317 4.3e-10 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211498
AA Change: R496G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5216 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RecQ subfamily and the DEAH (Asp-Glu-Ala-His) subfamily of DNA and RNA helicases. DNA helicases are involved in many aspects of DNA metabolism, including transcription, replication, recombination, and repair. This protein contains a nuclear localization signal in the C-terminus and shows a predominant nucleolar localization. It possesses an intrinsic 3' to 5' DNA helicase activity, and is also a 3' to 5' exonuclease. Based on interactions between this protein and Ku70/80 heterodimer in DNA end processing, this protein may be involved in the repair of double strand DNA breaks. Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show enhanced frequency and variety of tumors in conjunction with Trp53 knockout alleles. Homozygotes also have an elevated frequency of somatic reversion of the pink-eyed dilution unstable mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm2 T A 4: 144,291,635 (GRCm39) I24L probably benign Het
Ano1 A G 7: 144,187,426 (GRCm39) W447R possibly damaging Het
Blm T A 7: 80,105,165 (GRCm39) K103* probably null Het
Camta2 A G 11: 70,567,230 (GRCm39) I675T probably benign Het
Catsperz G A 19: 6,902,450 (GRCm39) R15C probably damaging Het
Chd1l T C 3: 97,510,964 (GRCm39) probably benign Het
Corin C A 5: 72,462,276 (GRCm39) E844D possibly damaging Het
Cyb5rl T G 4: 106,938,104 (GRCm39) M127R probably damaging Het
Dcdc2a A T 13: 25,286,569 (GRCm39) N164I possibly damaging Het
Dnah6 A G 6: 73,185,528 (GRCm39) probably null Het
Emilin2 T C 17: 71,562,960 (GRCm39) probably benign Het
Epb41l2 T A 10: 25,319,800 (GRCm39) V211D probably damaging Het
Fbxo47 C T 11: 97,759,427 (GRCm39) M166I probably benign Het
Golm1 T C 13: 59,786,187 (GRCm39) D335G probably damaging Het
Gpn1 T A 5: 31,660,773 (GRCm39) M188K probably damaging Het
Gpr84 T A 15: 103,217,646 (GRCm39) S144C probably damaging Het
Grm8 G T 6: 27,981,200 (GRCm39) Q237K possibly damaging Het
Gsdmd C A 15: 75,738,908 (GRCm39) probably null Het
Hmgcr G A 13: 96,795,528 (GRCm39) T347I probably damaging Het
Hsd17b7 T A 1: 169,788,774 (GRCm39) probably benign Het
Hsd3b9 G A 3: 98,354,182 (GRCm39) Q106* probably null Het
Klhl7 T G 5: 24,364,489 (GRCm39) W508G probably damaging Het
Lrp2 C A 2: 69,258,948 (GRCm39) D4581Y probably damaging Het
Lrrc7 T C 3: 157,840,968 (GRCm39) N1357D probably benign Het
Macf1 T C 4: 123,380,451 (GRCm39) probably benign Het
Mroh7 T C 4: 106,577,692 (GRCm39) T329A probably damaging Het
Mroh9 C T 1: 162,871,552 (GRCm39) probably null Het
Mta2 A G 19: 8,926,550 (GRCm39) probably benign Het
Myo3a A T 2: 22,271,906 (GRCm39) probably benign Het
Nrip2 A G 6: 128,384,352 (GRCm39) D153G probably benign Het
Nup133 T C 8: 124,644,156 (GRCm39) probably benign Het
Nup210 C T 6: 91,019,329 (GRCm39) V259M possibly damaging Het
Or10ak14 C T 4: 118,610,816 (GRCm39) M308I probably benign Het
Or5b112 A T 19: 13,319,211 (GRCm39) I30F probably benign Het
Or9i14 A T 19: 13,792,726 (GRCm39) V76D probably damaging Het
Otog C T 7: 45,939,113 (GRCm39) R2048C probably damaging Het
Pacc1 T C 1: 191,080,632 (GRCm39) V284A probably damaging Het
Paqr7 T C 4: 134,235,124 (GRCm39) L327P probably damaging Het
Parl A G 16: 20,105,676 (GRCm39) S249P probably damaging Het
Phc1 A G 6: 122,302,833 (GRCm39) I230T probably benign Het
Pitpnm1 T G 19: 4,160,831 (GRCm39) probably null Het
Plpp1 A G 13: 112,971,477 (GRCm39) Y48C probably damaging Het
Pxdc1 A G 13: 34,812,870 (GRCm39) F194L probably benign Het
Rp1 A T 1: 4,416,159 (GRCm39) V1651D possibly damaging Het
Serpinb1c T A 13: 33,080,943 (GRCm39) R47* probably null Het
Sis T C 3: 72,853,915 (GRCm39) T521A possibly damaging Het
Slc16a9 A G 10: 70,118,308 (GRCm39) D209G probably benign Het
Slc26a4 A T 12: 31,575,567 (GRCm39) C706* probably null Het
Slc37a2 A G 9: 37,148,177 (GRCm39) V325A probably benign Het
Speg T A 1: 75,378,145 (GRCm39) D784E probably damaging Het
Sycp1 T C 3: 102,827,938 (GRCm39) I270V probably benign Het
Tatdn2 T A 6: 113,681,076 (GRCm39) F309I probably damaging Het
Tmem67 T C 4: 12,089,400 (GRCm39) probably benign Het
Trpm1 T A 7: 63,852,801 (GRCm39) probably null Het
Zfhx2 A G 14: 55,300,854 (GRCm39) V2299A probably benign Het
Zfp819 T A 7: 43,266,524 (GRCm39) S260T possibly damaging Het
Other mutations in Wrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Wrn APN 8 33,812,405 (GRCm39) splice site probably benign
IGL00661:Wrn APN 8 33,809,173 (GRCm39) splice site probably benign
IGL01472:Wrn APN 8 33,819,200 (GRCm39) missense possibly damaging 0.93
IGL01544:Wrn APN 8 33,814,554 (GRCm39) missense probably benign 0.00
IGL01599:Wrn APN 8 33,731,039 (GRCm39) missense possibly damaging 0.69
IGL01688:Wrn APN 8 33,800,730 (GRCm39) splice site probably benign
IGL01916:Wrn APN 8 33,747,252 (GRCm39) missense possibly damaging 0.78
IGL01925:Wrn APN 8 33,809,208 (GRCm39) missense probably benign 0.42
IGL02068:Wrn APN 8 33,800,777 (GRCm39) missense probably benign 0.38
IGL02084:Wrn APN 8 33,775,207 (GRCm39) missense probably benign
IGL02167:Wrn APN 8 33,807,583 (GRCm39) missense probably damaging 1.00
IGL02230:Wrn APN 8 33,807,591 (GRCm39) missense probably damaging 1.00
IGL02717:Wrn APN 8 33,833,601 (GRCm39) missense probably damaging 1.00
IGL02982:Wrn APN 8 33,833,094 (GRCm39) missense probably damaging 1.00
IGL03030:Wrn APN 8 33,738,989 (GRCm39) missense possibly damaging 0.94
IGL03088:Wrn APN 8 33,758,851 (GRCm39) splice site probably benign
IGL03179:Wrn APN 8 33,800,734 (GRCm39) splice site probably null
IGL03306:Wrn APN 8 33,826,149 (GRCm39) missense probably damaging 1.00
R0004:Wrn UTSW 8 33,807,588 (GRCm39) missense probably damaging 1.00
R0190:Wrn UTSW 8 33,731,011 (GRCm39) missense probably benign 0.02
R0441:Wrn UTSW 8 33,758,778 (GRCm39) missense probably benign 0.24
R0463:Wrn UTSW 8 33,770,843 (GRCm39) missense possibly damaging 0.84
R0538:Wrn UTSW 8 33,826,119 (GRCm39) missense probably damaging 0.99
R0682:Wrn UTSW 8 33,757,848 (GRCm39) missense probably benign 0.00
R0729:Wrn UTSW 8 33,738,946 (GRCm39) splice site probably null
R0744:Wrn UTSW 8 33,785,034 (GRCm39) missense possibly damaging 0.91
R0836:Wrn UTSW 8 33,785,034 (GRCm39) missense possibly damaging 0.91
R1168:Wrn UTSW 8 33,806,436 (GRCm39) missense probably damaging 1.00
R1352:Wrn UTSW 8 33,784,944 (GRCm39) missense probably benign 0.25
R1396:Wrn UTSW 8 33,758,847 (GRCm39) missense probably damaging 1.00
R1432:Wrn UTSW 8 33,809,169 (GRCm39) splice site probably benign
R1523:Wrn UTSW 8 33,782,744 (GRCm39) missense probably benign 0.23
R1625:Wrn UTSW 8 33,819,158 (GRCm39) missense probably benign 0.01
R1664:Wrn UTSW 8 33,770,794 (GRCm39) splice site probably null
R1773:Wrn UTSW 8 33,833,589 (GRCm39) missense probably damaging 1.00
R1864:Wrn UTSW 8 33,778,892 (GRCm39) missense probably damaging 0.99
R1868:Wrn UTSW 8 33,747,249 (GRCm39) missense probably benign 0.03
R2011:Wrn UTSW 8 33,726,432 (GRCm39) missense probably benign 0.02
R2075:Wrn UTSW 8 33,812,357 (GRCm39) missense probably benign 0.00
R2091:Wrn UTSW 8 33,757,853 (GRCm39) missense probably benign
R2213:Wrn UTSW 8 33,747,043 (GRCm39) missense probably benign 0.05
R2255:Wrn UTSW 8 33,819,230 (GRCm39) missense probably benign 0.13
R2276:Wrn UTSW 8 33,814,584 (GRCm39) missense probably benign 0.02
R3177:Wrn UTSW 8 33,807,582 (GRCm39) missense probably damaging 1.00
R3277:Wrn UTSW 8 33,807,582 (GRCm39) missense probably damaging 1.00
R3779:Wrn UTSW 8 33,731,048 (GRCm39) missense probably damaging 1.00
R3827:Wrn UTSW 8 33,814,548 (GRCm39) missense probably benign 0.00
R4111:Wrn UTSW 8 33,842,183 (GRCm39) missense probably benign 0.02
R4392:Wrn UTSW 8 33,741,860 (GRCm39) missense probably damaging 0.99
R4458:Wrn UTSW 8 33,785,026 (GRCm39) missense probably damaging 0.99
R4650:Wrn UTSW 8 33,745,537 (GRCm39) missense probably benign 0.05
R4656:Wrn UTSW 8 33,826,019 (GRCm39) splice site probably null
R4657:Wrn UTSW 8 33,826,019 (GRCm39) splice site probably null
R4667:Wrn UTSW 8 33,814,366 (GRCm39) missense probably benign 0.00
R4735:Wrn UTSW 8 33,775,250 (GRCm39) missense probably damaging 1.00
R4933:Wrn UTSW 8 33,812,371 (GRCm39) missense probably benign 0.01
R5104:Wrn UTSW 8 33,757,895 (GRCm39) splice site probably null
R5166:Wrn UTSW 8 33,842,100 (GRCm39) critical splice donor site probably null
R5279:Wrn UTSW 8 33,731,129 (GRCm39) missense probably damaging 1.00
R5400:Wrn UTSW 8 33,784,945 (GRCm39) missense probably benign 0.02
R5575:Wrn UTSW 8 33,826,158 (GRCm39) missense probably benign 0.02
R5695:Wrn UTSW 8 33,814,346 (GRCm39) missense probably benign 0.26
R5729:Wrn UTSW 8 33,758,806 (GRCm39) missense probably benign 0.02
R6044:Wrn UTSW 8 33,726,457 (GRCm39) missense probably damaging 1.00
R6139:Wrn UTSW 8 33,843,360 (GRCm39) missense probably damaging 1.00
R6158:Wrn UTSW 8 33,809,200 (GRCm39) missense probably damaging 1.00
R6192:Wrn UTSW 8 33,774,682 (GRCm39) missense probably benign 0.12
R6243:Wrn UTSW 8 33,774,682 (GRCm39) missense possibly damaging 0.94
R6354:Wrn UTSW 8 33,833,666 (GRCm39) missense possibly damaging 0.93
R6429:Wrn UTSW 8 33,833,024 (GRCm39) missense probably damaging 1.00
R6490:Wrn UTSW 8 33,809,248 (GRCm39) missense probably benign 0.01
R6529:Wrn UTSW 8 33,826,004 (GRCm39) splice site probably null
R6535:Wrn UTSW 8 33,826,131 (GRCm39) missense probably damaging 0.99
R7001:Wrn UTSW 8 33,842,157 (GRCm39) missense probably benign 0.04
R7114:Wrn UTSW 8 33,775,149 (GRCm39) frame shift probably null
R7198:Wrn UTSW 8 33,814,346 (GRCm39) missense probably benign 0.00
R7200:Wrn UTSW 8 33,812,376 (GRCm39) missense probably benign 0.00
R7227:Wrn UTSW 8 33,738,974 (GRCm39) missense probably damaging 1.00
R7299:Wrn UTSW 8 33,782,746 (GRCm39) missense probably damaging 1.00
R7374:Wrn UTSW 8 33,758,939 (GRCm39) missense probably damaging 1.00
R7402:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7404:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7405:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7464:Wrn UTSW 8 33,826,024 (GRCm39) critical splice donor site probably null
R7474:Wrn UTSW 8 33,819,209 (GRCm39) missense probably damaging 0.96
R7609:Wrn UTSW 8 33,800,741 (GRCm39) missense possibly damaging 0.50
R7729:Wrn UTSW 8 33,814,454 (GRCm39) missense probably benign 0.21
R7830:Wrn UTSW 8 33,759,082 (GRCm39) missense probably damaging 0.97
R7998:Wrn UTSW 8 33,782,671 (GRCm39) missense probably benign 0.10
R8239:Wrn UTSW 8 33,819,213 (GRCm39) missense probably damaging 1.00
R8262:Wrn UTSW 8 33,814,274 (GRCm39) missense probably benign 0.07
R8410:Wrn UTSW 8 33,759,048 (GRCm39) missense probably damaging 1.00
R8480:Wrn UTSW 8 33,778,796 (GRCm39) missense probably benign 0.10
R8530:Wrn UTSW 8 33,770,852 (GRCm39) missense possibly damaging 0.83
R8540:Wrn UTSW 8 33,842,154 (GRCm39) missense probably damaging 0.96
R8708:Wrn UTSW 8 33,782,671 (GRCm39) missense probably damaging 0.96
R8783:Wrn UTSW 8 33,826,041 (GRCm39) missense probably null 1.00
R8870:Wrn UTSW 8 33,819,220 (GRCm39) missense probably benign 0.01
R8876:Wrn UTSW 8 33,814,422 (GRCm39) missense probably benign 0.00
R9050:Wrn UTSW 8 33,833,021 (GRCm39) missense probably damaging 1.00
R9329:Wrn UTSW 8 33,731,006 (GRCm39) missense probably benign
R9595:Wrn UTSW 8 33,758,961 (GRCm39) missense probably benign
R9621:Wrn UTSW 8 33,814,301 (GRCm39) missense probably benign 0.01
R9623:Wrn UTSW 8 33,774,644 (GRCm39) critical splice donor site probably null
R9797:Wrn UTSW 8 33,758,950 (GRCm39) missense probably benign 0.02
RF010:Wrn UTSW 8 33,778,793 (GRCm39) missense probably benign 0.13
X0017:Wrn UTSW 8 33,770,810 (GRCm39) missense probably damaging 1.00
Z1176:Wrn UTSW 8 33,824,237 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCTTTATCAGAGTGGTGAAACTGTGC -3'
(R):5'- TGCAGACACGTCCTTAAACCTTGG -3'

Sequencing Primer
(F):5'- CAGAGTGGTGAAACTGTGCTTAATAC -3'
(R):5'- GCAACAGTGAAATTATTCTCTCACC -3'
Posted On 2014-02-18