Incidental Mutation 'R1301:Slc37a2'
ID158375
Institutional Source Beutler Lab
Gene Symbol Slc37a2
Ensembl Gene ENSMUSG00000032122
Gene Namesolute carrier family 37 (glycerol-3-phosphate transporter), member 2
SynonymscI-2, ci2, G3PP, Slc37a1
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1301 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37227585-37255738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37236881 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 325 (V325A)
Ref Sequence ENSEMBL: ENSMUSP00000124569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115068] [ENSMUST00000161114]
Predicted Effect probably benign
Transcript: ENSMUST00000115068
AA Change: V325A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110720
Gene: ENSMUSG00000032122
AA Change: V325A

DomainStartEndE-ValueType
Pfam:MFS_1 23 424 1.2e-40 PFAM
transmembrane domain 431 453 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161114
AA Change: V325A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124569
Gene: ENSMUSG00000032122
AA Change: V325A

DomainStartEndE-ValueType
Pfam:MFS_1 24 426 1.2e-40 PFAM
transmembrane domain 431 453 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162018
Meta Mutation Damage Score 0.1722 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Slc37a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01643:Slc37a2 APN 9 37235553 splice site probably benign
IGL01719:Slc37a2 APN 9 37234178 missense probably damaging 1.00
IGL02039:Slc37a2 APN 9 37233684 missense probably damaging 0.98
IGL02286:Slc37a2 APN 9 37235159 missense probably damaging 1.00
IGL02951:Slc37a2 APN 9 37255315 missense probably benign 0.00
PIT4581001:Slc37a2 UTSW 9 37237405 missense probably benign 0.00
R0547:Slc37a2 UTSW 9 37233122 splice site probably null
R0689:Slc37a2 UTSW 9 37235550 splice site probably benign
R3927:Slc37a2 UTSW 9 37235507 missense probably damaging 1.00
R4834:Slc37a2 UTSW 9 37235108 missense probably damaging 0.97
R5154:Slc37a2 UTSW 9 37231643 makesense probably null
R5292:Slc37a2 UTSW 9 37239157 nonsense probably null
R6150:Slc37a2 UTSW 9 37238347 missense probably damaging 1.00
R6959:Slc37a2 UTSW 9 37241334 missense probably benign
R7014:Slc37a2 UTSW 9 37233887 missense probably damaging 1.00
R7605:Slc37a2 UTSW 9 37237328 missense possibly damaging 0.71
R8342:Slc37a2 UTSW 9 37238214 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCACACAGCCTCTTCCTTGAATTGG -3'
(R):5'- AGGACATGCAGCATTAGGCACAC -3'

Sequencing Primer
(F):5'- GTAGGACAGAGTTTTCCTCCTAAG -3'
(R):5'- AGCATTAGGCACACTGCTG -3'
Posted On2014-02-18