Incidental Mutation 'R1301:Camta2'
ID158378
Institutional Source Beutler Lab
Gene Symbol Camta2
Ensembl Gene ENSMUSG00000040712
Gene Namecalmodulin binding transcription activator 2
SynonymsKiaa0909-hp
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R1301 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70669463-70688105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70676404 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 675 (I675T)
Ref Sequence ENSEMBL: ENSMUSP00000098493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036299] [ENSMUST00000100933] [ENSMUST00000108544] [ENSMUST00000108545] [ENSMUST00000119120] [ENSMUST00000120261] [ENSMUST00000145823]
Predicted Effect probably benign
Transcript: ENSMUST00000036299
AA Change: I678T

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000043792
Gene: ENSMUSG00000040712
AA Change: I678T

DomainStartEndE-ValueType
CG-1 34 155 1.07e-83 SMART
low complexity region 232 243 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 370 380 N/A INTRINSIC
low complexity region 417 435 N/A INTRINSIC
low complexity region 461 485 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Pfam:TIG 541 621 6.2e-13 PFAM
low complexity region 660 679 N/A INTRINSIC
Blast:ANK 717 750 7e-12 BLAST
SCOP:d1myo__ 718 816 2e-15 SMART
Blast:ANK 762 792 4e-11 BLAST
low complexity region 829 839 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
IQ 1053 1075 2.59e2 SMART
IQ 1076 1092 2.38e2 SMART
IQ 1106 1128 5.42e0 SMART
low complexity region 1140 1157 N/A INTRINSIC
low complexity region 1180 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100933
AA Change: I675T

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098493
Gene: ENSMUSG00000040712
AA Change: I675T

DomainStartEndE-ValueType
CG-1 36 152 8.08e-88 SMART
low complexity region 229 240 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
low complexity region 414 432 N/A INTRINSIC
low complexity region 458 482 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
Pfam:TIG 538 618 1.2e-8 PFAM
low complexity region 657 676 N/A INTRINSIC
Blast:ANK 714 747 8e-12 BLAST
SCOP:d1myo__ 715 813 2e-15 SMART
Blast:ANK 759 789 4e-11 BLAST
low complexity region 826 836 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 858 879 N/A INTRINSIC
IQ 1050 1072 2.59e2 SMART
IQ 1073 1095 1.18e1 SMART
IQ 1096 1118 5.42e0 SMART
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1170 1180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108544
AA Change: I673T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104184
Gene: ENSMUSG00000040712
AA Change: I673T

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.2e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 4e-11 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1087 2.38e2 SMART
IQ 1101 1123 5.42e0 SMART
low complexity region 1135 1152 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108545
AA Change: I649T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104185
Gene: ENSMUSG00000040712
AA Change: I649T

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1.1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 5e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1069 1.18e1 SMART
IQ 1070 1092 5.42e0 SMART
low complexity region 1104 1121 N/A INTRINSIC
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119120
AA Change: I673T

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113847
Gene: ENSMUSG00000040712
AA Change: I673T

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.1e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 8e-13 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1093 1.18e1 SMART
IQ 1094 1116 5.42e0 SMART
low complexity region 1128 1145 N/A INTRINSIC
low complexity region 1168 1178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120261
AA Change: I649T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113667
Gene: ENSMUSG00000040712
AA Change: I649T

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 7e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1063 2.38e2 SMART
IQ 1077 1099 5.42e0 SMART
low complexity region 1111 1128 N/A INTRINSIC
low complexity region 1151 1161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125687
Predicted Effect probably benign
Transcript: ENSMUST00000145823
SMART Domains Protein: ENSMUSP00000123602
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 137 2.55e-44 SMART
low complexity region 146 165 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the calmodulin-binding transcription activator protein family. Members of this family share a common domain structure that consists of a transcription activation domain, a DNA-binding domain, and a calmodulin-binding domain. The encoded protein may be a transcriptional coactivator of genes involved in cardiac growth. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and free of obvious cardiac defects, but show reduced pathophysiologic cardiac hypertrophy in response to diverse stress stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Camta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Camta2 APN 11 70671482 nonsense probably null
IGL01472:Camta2 APN 11 70684124 missense probably damaging 1.00
IGL02548:Camta2 APN 11 70670685 missense probably damaging 1.00
IGL02794:Camta2 APN 11 70675658 missense possibly damaging 0.94
IGL02983:Camta2 APN 11 70672022 missense probably damaging 0.99
IGL03035:Camta2 APN 11 70671509 nonsense probably null
weeping UTSW 11 70683308 missense probably damaging 1.00
Willow UTSW 11 70678325 missense probably damaging 1.00
P0027:Camta2 UTSW 11 70684005 missense probably damaging 1.00
R0360:Camta2 UTSW 11 70683310 missense probably damaging 1.00
R0364:Camta2 UTSW 11 70683310 missense probably damaging 1.00
R0541:Camta2 UTSW 11 70681621 missense probably benign 0.01
R0600:Camta2 UTSW 11 70673959 missense possibly damaging 0.94
R0630:Camta2 UTSW 11 70678305 missense probably damaging 1.00
R1346:Camta2 UTSW 11 70676467 missense possibly damaging 0.89
R1826:Camta2 UTSW 11 70683308 missense probably damaging 1.00
R1881:Camta2 UTSW 11 70672016 missense probably benign 0.00
R1980:Camta2 UTSW 11 70682482 missense probably benign 0.43
R2144:Camta2 UTSW 11 70671575 missense probably benign 0.31
R2145:Camta2 UTSW 11 70671575 missense probably benign 0.31
R2763:Camta2 UTSW 11 70682530 nonsense probably null
R2881:Camta2 UTSW 11 70679664 splice site probably null
R2917:Camta2 UTSW 11 70680961 missense probably damaging 1.00
R4115:Camta2 UTSW 11 70676474 missense possibly damaging 0.93
R4321:Camta2 UTSW 11 70678325 missense probably damaging 1.00
R4470:Camta2 UTSW 11 70680940 missense probably damaging 1.00
R4499:Camta2 UTSW 11 70674686 missense probably damaging 1.00
R4509:Camta2 UTSW 11 70681018 missense probably benign 0.28
R6154:Camta2 UTSW 11 70678385 missense probably damaging 1.00
R6166:Camta2 UTSW 11 70674261 splice site probably null
R6287:Camta2 UTSW 11 70681469 missense probably damaging 0.98
R6382:Camta2 UTSW 11 70672041 missense probably damaging 0.99
R6864:Camta2 UTSW 11 70671966 missense probably benign 0.00
R6922:Camta2 UTSW 11 70674138 missense probably benign 0.04
R7438:Camta2 UTSW 11 70683888 critical splice donor site probably null
R7611:Camta2 UTSW 11 70681546 missense possibly damaging 0.85
R7883:Camta2 UTSW 11 70675211 missense probably damaging 1.00
R8094:Camta2 UTSW 11 70686077 missense probably damaging 1.00
R8232:Camta2 UTSW 11 70683015 missense unknown
R8271:Camta2 UTSW 11 70671060 missense probably benign 0.05
T0722:Camta2 UTSW 11 70684005 missense probably damaging 1.00
X0066:Camta2 UTSW 11 70681678 missense probably benign 0.08
Z1177:Camta2 UTSW 11 70675221 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAATAGTCCCAAGCCTGTCATGCC -3'
(R):5'- GCGTAGAGGAAGAACAAGCTCCATC -3'

Sequencing Primer
(F):5'- AAGCCTGTCATGCCACGAG -3'
(R):5'- GAGTACAACTCCTAGTAGTGTTCC -3'
Posted On2014-02-18