Incidental Mutation 'R1301:Golm1'
ID158384
Institutional Source Beutler Lab
Gene Symbol Golm1
Ensembl Gene ENSMUSG00000021556
Gene Namegolgi membrane protein 1
Synonyms2310001L02Rik, GP73, PSEC0257, D030064E01Rik, Golph2
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1301 (G1)
Quality Score221
Status Validated
Chromosome13
Chromosomal Location59634626-59675811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59638373 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 335 (D335G)
Ref Sequence ENSEMBL: ENSMUSP00000093410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022038] [ENSMUST00000022039] [ENSMUST00000095739]
Predicted Effect probably benign
Transcript: ENSMUST00000022038
SMART Domains Protein: ENSMUSP00000022038
Gene: ENSMUSG00000021555

DomainStartEndE-ValueType
Pfam:Mak10 45 145 2.2e-29 PFAM
Pfam:Mak10 141 194 3.7e-10 PFAM
low complexity region 561 568 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000022039
AA Change: D335G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022039
Gene: ENSMUSG00000021556
AA Change: D335G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095739
AA Change: D335G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093410
Gene: ENSMUSG00000021556
AA Change: D335G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172118
Meta Mutation Damage Score 0.1445 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased premature lethality with kidney abnormalities and liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Golm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Golm1 APN 13 59649656 missense probably damaging 0.99
IGL01327:Golm1 APN 13 59645144 missense possibly damaging 0.95
IGL02348:Golm1 APN 13 59638377 missense probably benign 0.00
R0047:Golm1 UTSW 13 59645100 missense probably benign 0.03
R0047:Golm1 UTSW 13 59645100 missense probably benign 0.03
R0458:Golm1 UTSW 13 59664364 missense probably damaging 0.98
R0989:Golm1 UTSW 13 59640183 missense probably benign 0.01
R1804:Golm1 UTSW 13 59642389 critical splice acceptor site probably null
R1905:Golm1 UTSW 13 59642251 missense probably benign 0.04
R1940:Golm1 UTSW 13 59642237 splice site probably benign
R2086:Golm1 UTSW 13 59645185 nonsense probably null
R2513:Golm1 UTSW 13 59642258 missense probably benign 0.01
R2887:Golm1 UTSW 13 59640230 missense probably benign 0.00
R3903:Golm1 UTSW 13 59638340 missense probably damaging 1.00
R4154:Golm1 UTSW 13 59642353 missense probably benign 0.01
R5580:Golm1 UTSW 13 59642365 missense probably benign 0.03
R6193:Golm1 UTSW 13 59645158 missense probably benign 0.00
R6418:Golm1 UTSW 13 59665561 missense probably damaging 1.00
R6594:Golm1 UTSW 13 59664227 missense possibly damaging 0.79
R6604:Golm1 UTSW 13 59638383 missense probably damaging 1.00
R6967:Golm1 UTSW 13 59649576 small deletion probably benign
R6968:Golm1 UTSW 13 59649576 small deletion probably benign
R6991:Golm1 UTSW 13 59649576 small deletion probably benign
R6992:Golm1 UTSW 13 59649576 small deletion probably benign
R6993:Golm1 UTSW 13 59649576 small deletion probably benign
R6996:Golm1 UTSW 13 59642244 missense probably benign 0.00
R7576:Golm1 UTSW 13 59645106 missense probably benign 0.00
R7692:Golm1 UTSW 13 59640257 missense probably benign 0.08
R7863:Golm1 UTSW 13 59649569 missense probably damaging 1.00
R7948:Golm1 UTSW 13 59664197 critical splice donor site probably null
X0026:Golm1 UTSW 13 59638313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGTGGAACGACTAGAGTGCCC -3'
(R):5'- GCCATCAGTCAGGCTACTTTCTGAG -3'

Sequencing Primer
(F):5'- CTTGTTGGGAAAGCCCTGAATC -3'
(R):5'- CAGGCTACTTTCTGAGGTACAG -3'
Posted On2014-02-18