Incidental Mutation 'R1301:Zfhx2'
ID158387
Institutional Source Beutler Lab
Gene Symbol Zfhx2
Ensembl Gene ENSMUSG00000040721
Gene Namezinc finger homeobox 2
Synonymszfh-5
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R1301 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55060262-55092324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55063397 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2299 (V2299A)
Ref Sequence ENSEMBL: ENSMUSP00000045156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036328] [ENSMUST00000183822] [ENSMUST00000185121]
Predicted Effect probably benign
Transcript: ENSMUST00000036328
AA Change: V2299A

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045156
Gene: ENSMUSG00000040721
AA Change: V2299A

DomainStartEndE-ValueType
low complexity region 22 42 N/A INTRINSIC
ZnF_C2H2 230 252 1.43e1 SMART
low complexity region 333 345 N/A INTRINSIC
low complexity region 428 439 N/A INTRINSIC
ZnF_C2H2 446 469 8.94e-3 SMART
ZnF_U1 498 532 6.98e-1 SMART
ZnF_C2H2 501 525 3.21e-4 SMART
ZnF_U1 560 594 1.36e0 SMART
ZnF_C2H2 563 587 3.29e-1 SMART
low complexity region 597 623 N/A INTRINSIC
ZnF_C2H2 752 776 6.4e0 SMART
ZnF_C2H2 815 839 2.02e-1 SMART
ZnF_U1 861 895 1.78e1 SMART
ZnF_C2H2 864 888 5.34e-1 SMART
ZnF_C2H2 974 997 1.51e1 SMART
ZnF_C2H2 1003 1026 1.51e0 SMART
low complexity region 1087 1103 N/A INTRINSIC
low complexity region 1106 1126 N/A INTRINSIC
ZnF_U1 1182 1216 3.42e0 SMART
ZnF_C2H2 1185 1209 8.22e-2 SMART
ZnF_U1 1239 1273 3.73e0 SMART
ZnF_C2H2 1242 1266 6.67e-2 SMART
low complexity region 1277 1304 N/A INTRINSIC
low complexity region 1314 1326 N/A INTRINSIC
low complexity region 1332 1346 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
low complexity region 1379 1400 N/A INTRINSIC
low complexity region 1457 1465 N/A INTRINSIC
ZnF_C2H2 1474 1497 5.34e0 SMART
low complexity region 1522 1531 N/A INTRINSIC
low complexity region 1542 1554 N/A INTRINSIC
low complexity region 1562 1583 N/A INTRINSIC
HOX 1589 1651 1.97e-16 SMART
low complexity region 1656 1665 N/A INTRINSIC
coiled coil region 1693 1723 N/A INTRINSIC
ZnF_C2H2 1761 1783 2.53e-2 SMART
low complexity region 1837 1847 N/A INTRINSIC
HOX 1851 1913 2.34e-18 SMART
low complexity region 1984 1995 N/A INTRINSIC
low complexity region 2001 2051 N/A INTRINSIC
HOX 2058 2120 1.52e-17 SMART
ZnF_U1 2136 2170 1.09e1 SMART
ZnF_C2H2 2139 2163 5.4e1 SMART
low complexity region 2328 2354 N/A INTRINSIC
low complexity region 2385 2426 N/A INTRINSIC
ZnF_U1 2482 2516 8.31e-1 SMART
ZnF_C2H2 2485 2509 9.46e0 SMART
low complexity region 2523 2538 N/A INTRINSIC
low complexity region 2553 2562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176665
SMART Domains Protein: ENSMUSP00000134955
Gene: ENSMUSG00000040721

DomainStartEndE-ValueType
ZnF_C2H2 13 37 5.34e-1 SMART
ZnF_C2H2 133 156 1.51e1 SMART
ZnF_C2H2 162 185 1.51e0 SMART
low complexity region 246 262 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
ZnF_C2H2 344 368 8.22e-2 SMART
ZnF_C2H2 401 425 6.67e-2 SMART
low complexity region 436 463 N/A INTRINSIC
low complexity region 473 485 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
low complexity region 538 559 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183822
SMART Domains Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
PDB:2JMU|A 5 64 3e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185121
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Zfhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Zfhx2 APN 14 55066565 missense possibly damaging 0.93
IGL00164:Zfhx2 APN 14 55065026 missense possibly damaging 0.73
IGL00235:Zfhx2 APN 14 55063257 missense probably benign 0.11
IGL00925:Zfhx2 APN 14 55073061 missense probably benign 0.06
IGL01025:Zfhx2 APN 14 55064260 missense probably damaging 1.00
IGL01061:Zfhx2 APN 14 55073882 missense possibly damaging 0.96
IGL01486:Zfhx2 APN 14 55067090 missense probably damaging 1.00
IGL01875:Zfhx2 APN 14 55063915 missense unknown
IGL01990:Zfhx2 APN 14 55073590 missense probably damaging 0.99
IGL02097:Zfhx2 APN 14 55062894 missense probably damaging 1.00
IGL02269:Zfhx2 APN 14 55071936 missense probably benign 0.00
IGL02488:Zfhx2 APN 14 55065103 missense possibly damaging 0.72
IGL02624:Zfhx2 APN 14 55066628 missense probably benign 0.06
IGL03087:Zfhx2 APN 14 55072845 missense possibly damaging 0.85
PIT4403001:Zfhx2 UTSW 14 55074980 missense probably benign
R0148:Zfhx2 UTSW 14 55072897 missense possibly damaging 0.86
R0323:Zfhx2 UTSW 14 55065979 missense possibly damaging 0.73
R0328:Zfhx2 UTSW 14 55071988 missense probably benign
R0348:Zfhx2 UTSW 14 55063508 missense probably damaging 0.99
R0442:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
R0533:Zfhx2 UTSW 14 55064090 missense probably benign 0.23
R0561:Zfhx2 UTSW 14 55065889 missense probably benign 0.01
R0627:Zfhx2 UTSW 14 55065327 missense probably benign
R0659:Zfhx2 UTSW 14 55073801 missense possibly damaging 0.73
R0675:Zfhx2 UTSW 14 55063163 missense probably damaging 0.99
R1563:Zfhx2 UTSW 14 55065088 missense probably benign 0.33
R1607:Zfhx2 UTSW 14 55062985 missense probably damaging 1.00
R1694:Zfhx2 UTSW 14 55073944 missense possibly damaging 0.91
R1710:Zfhx2 UTSW 14 55065998 missense possibly damaging 0.70
R1773:Zfhx2 UTSW 14 55072891 missense possibly damaging 0.53
R1879:Zfhx2 UTSW 14 55065617 missense probably benign 0.32
R1879:Zfhx2 UTSW 14 55072749 missense possibly damaging 0.96
R1933:Zfhx2 UTSW 14 55075238 start gained probably benign
R1944:Zfhx2 UTSW 14 55074732 missense probably benign 0.18
R2888:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2889:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2915:Zfhx2 UTSW 14 55064557 missense probably damaging 0.98
R3971:Zfhx2 UTSW 14 55074475 missense probably benign 0.33
R4082:Zfhx2 UTSW 14 55065205 missense probably benign
R4134:Zfhx2 UTSW 14 55065143 missense possibly damaging 0.93
R4231:Zfhx2 UTSW 14 55073534 missense possibly damaging 0.73
R4675:Zfhx2 UTSW 14 55067221 missense probably benign 0.03
R4764:Zfhx2 UTSW 14 55066915 missense possibly damaging 0.96
R4866:Zfhx2 UTSW 14 55065536 missense possibly damaging 0.73
R4940:Zfhx2 UTSW 14 55066434 missense possibly damaging 0.53
R5125:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5178:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5554:Zfhx2 UTSW 14 55064317 missense probably damaging 1.00
R5689:Zfhx2 UTSW 14 55073903 missense possibly damaging 0.53
R5768:Zfhx2 UTSW 14 55074365 missense probably benign
R5792:Zfhx2 UTSW 14 55066846 missense possibly damaging 0.72
R5834:Zfhx2 UTSW 14 55073330 nonsense probably null
R5895:Zfhx2 UTSW 14 55065891 missense probably benign
R5999:Zfhx2 UTSW 14 55074005 missense probably benign
R6025:Zfhx2 UTSW 14 55065208 missense probably benign 0.00
R6106:Zfhx2 UTSW 14 55068310 critical splice acceptor site probably null
R6135:Zfhx2 UTSW 14 55074196 missense possibly damaging 0.85
R6186:Zfhx2 UTSW 14 55063160 missense probably damaging 0.99
R6379:Zfhx2 UTSW 14 55074338 missense probably benign
R6725:Zfhx2 UTSW 14 55064082 nonsense probably null
R7089:Zfhx2 UTSW 14 55065772 missense probably benign 0.33
R7383:Zfhx2 UTSW 14 55068253 missense probably benign 0.00
R7470:Zfhx2 UTSW 14 55066750 missense possibly damaging 0.52
R7606:Zfhx2 UTSW 14 55066663 missense probably benign 0.12
R7607:Zfhx2 UTSW 14 55066231 missense possibly damaging 0.86
R7698:Zfhx2 UTSW 14 55062849 missense probably benign 0.00
R7730:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
R8142:Zfhx2 UTSW 14 55073438 missense possibly damaging 0.86
R8188:Zfhx2 UTSW 14 55064441 missense probably benign 0.18
R8212:Zfhx2 UTSW 14 55072916 missense possibly damaging 0.70
R8264:Zfhx2 UTSW 14 55065512 missense possibly damaging 0.53
R8331:Zfhx2 UTSW 14 55071987 missense probably benign 0.00
R8369:Zfhx2 UTSW 14 55066744 missense probably benign 0.05
R8371:Zfhx2 UTSW 14 55064092 missense probably damaging 0.99
R8383:Zfhx2 UTSW 14 55074071 missense possibly damaging 0.73
R8415:Zfhx2 UTSW 14 55070622 missense probably benign
R8441:Zfhx2 UTSW 14 55066528 missense possibly damaging 0.96
R8504:Zfhx2 UTSW 14 55065786 missense probably benign 0.00
X0065:Zfhx2 UTSW 14 55066960 missense probably benign 0.33
Z1088:Zfhx2 UTSW 14 55074180 missense possibly damaging 0.73
Z1177:Zfhx2 UTSW 14 55065920 missense probably benign 0.40
Z1177:Zfhx2 UTSW 14 55066982 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CGTAAAGCTGTTGGAAGTATGCCCC -3'
(R):5'- CTGTGAGGCTGGACACCATTAACC -3'

Sequencing Primer
(F):5'- GAAGTATGCCCCCTGTAACTGAG -3'
(R):5'- GGACACCATTAACCCTTCATTATG -3'
Posted On2014-02-18