Incidental Mutation 'R1301:Parl'
ID158389
Institutional Source Beutler Lab
Gene Symbol Parl
Ensembl Gene ENSMUSG00000033918
Gene Namepresenilin associated, rhomboid-like
SynonymsD16Ertd607e, PSENIP2, PRO2207, PSARL1, Psarl
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R1301 (G1)
Quality Score213
Status Validated
Chromosome16
Chromosomal Location20279818-20302387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20286926 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 249 (S249P)
Ref Sequence ENSEMBL: ENSMUSP00000155974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048642] [ENSMUST00000133153] [ENSMUST00000136252] [ENSMUST00000152887] [ENSMUST00000232036] [ENSMUST00000232484]
Predicted Effect probably damaging
Transcript: ENSMUST00000048642
AA Change: S249P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045361
Gene: ENSMUSG00000033918
AA Change: S249P

DomainStartEndE-ValueType
transmembrane domain 100 119 N/A INTRINSIC
transmembrane domain 166 185 N/A INTRINSIC
Pfam:Rhomboid 199 351 9.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126001
Predicted Effect probably benign
Transcript: ENSMUST00000133153
Predicted Effect probably benign
Transcript: ENSMUST00000136252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136700
Predicted Effect probably damaging
Transcript: ENSMUST00000152887
AA Change: S60P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155832
Predicted Effect unknown
Transcript: ENSMUST00000231547
AA Change: S38P
Predicted Effect probably damaging
Transcript: ENSMUST00000232036
AA Change: S249P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232484
Meta Mutation Damage Score 0.8206 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhomboid family of intramembrane serine proteases that is localized to the inner mitochondrial membrane. The encoded protein regulates mitochondrial remodeling and apoptosis through regulated substrate proteolysis. Proteolytic processing of the encoded protein results in the release of a small peptide, P-beta, which may transit to the nucleus. Mutations in this gene may be associated with Parkinson's disease. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice show stunted growth, lymphocyte and neuron apoptosis, faster apoptotic cristae remodeling and cytochrome c release from mitochondria, dyspnea, cryptorchism, reduced testes and epididymi, kyphosis and premature death due to progressive cachexia sustained by multisystemic atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Parl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Parl APN 16 20298208 missense probably damaging 0.99
IGL01013:Parl APN 16 20282790 missense possibly damaging 0.50
IGL02159:Parl APN 16 20280088 splice site probably benign
IGL02189:Parl APN 16 20297703 missense probably damaging 1.00
R0233:Parl UTSW 16 20287907 missense probably damaging 0.96
R1954:Parl UTSW 16 20302327 start codon destroyed possibly damaging 0.95
R1955:Parl UTSW 16 20302327 start codon destroyed possibly damaging 0.95
R2353:Parl UTSW 16 20287040 missense probably benign 0.08
R3884:Parl UTSW 16 20283012 missense probably damaging 0.98
R5345:Parl UTSW 16 20298142 missense probably damaging 0.99
R5477:Parl UTSW 16 20280074 missense possibly damaging 0.90
R5567:Parl UTSW 16 20283012 missense probably damaging 0.97
R5687:Parl UTSW 16 20287978 intron probably benign
R6238:Parl UTSW 16 20302213 missense possibly damaging 0.94
R7311:Parl UTSW 16 20287875 missense probably benign 0.02
R8028:Parl UTSW 16 20280051 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CATCAGGCCCATTAGGTCCTGTTG -3'
(R):5'- TGACCGTGTGTTGTATGCTTACCAG -3'

Sequencing Primer
(F):5'- TGTGATAGTAAGGGCTTCACACC -3'
(R):5'- TGTTGTATGCTTACCAGGTATTTTC -3'
Posted On2014-02-18