Incidental Mutation 'R1301:Emilin2'
ID158390
Institutional Source Beutler Lab
Gene Symbol Emilin2
Ensembl Gene ENSMUSG00000024053
Gene Nameelastin microfibril interfacer 2
SynonymsFOAP-10, basilin
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1301 (G1)
Quality Score123
Status Validated
Chromosome17
Chromosomal Location71252176-71310965 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 71255965 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024849]
Predicted Effect probably benign
Transcript: ENSMUST00000024849
SMART Domains Protein: ENSMUSP00000024849
Gene: ENSMUSG00000024053

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:EMI 48 118 1.2e-18 PFAM
coiled coil region 181 216 N/A INTRINSIC
coiled coil region 259 308 N/A INTRINSIC
coiled coil region 590 618 N/A INTRINSIC
low complexity region 809 826 N/A INTRINSIC
low complexity region 833 848 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
Pfam:C1q 928 1067 5.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit disruptions in platelet activation, thrombus formation and clot retraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Olfr1499 A T 19: 13,815,362 V76D probably damaging Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Emilin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Emilin2 APN 17 71252859 missense possibly damaging 0.80
IGL01294:Emilin2 APN 17 71274594 missense probably benign 0.07
IGL02085:Emilin2 APN 17 71275149 missense probably damaging 0.99
IGL02433:Emilin2 APN 17 71274129 missense probably benign
IGL02587:Emilin2 APN 17 71280856 splice site probably benign
IGL02639:Emilin2 APN 17 71274549 missense probably benign 0.00
IGL02798:Emilin2 APN 17 71256695 splice site probably benign
IGL02952:Emilin2 APN 17 71280821 missense probably damaging 0.99
IGL02954:Emilin2 APN 17 71256531 missense probably benign 0.37
PIT4431001:Emilin2 UTSW 17 71255995 missense probably benign 0.16
PIT4802001:Emilin2 UTSW 17 71273469 missense probably damaging 1.00
R0011:Emilin2 UTSW 17 71273868 missense probably benign 0.01
R0033:Emilin2 UTSW 17 71275014 missense probably benign 0.27
R0784:Emilin2 UTSW 17 71275287 missense possibly damaging 0.83
R0830:Emilin2 UTSW 17 71273820 missense probably benign
R1394:Emilin2 UTSW 17 71253071 missense possibly damaging 0.79
R1501:Emilin2 UTSW 17 71310761 missense probably benign
R1576:Emilin2 UTSW 17 71255117 critical splice donor site probably null
R1676:Emilin2 UTSW 17 71274090 missense probably benign 0.14
R2063:Emilin2 UTSW 17 71274955 missense probably benign
R2149:Emilin2 UTSW 17 71273992 missense probably benign 0.06
R2238:Emilin2 UTSW 17 71274739 missense possibly damaging 0.83
R2239:Emilin2 UTSW 17 71310224 missense probably benign 0.00
R2380:Emilin2 UTSW 17 71310224 missense probably benign 0.00
R2420:Emilin2 UTSW 17 71274279 missense possibly damaging 0.90
R3721:Emilin2 UTSW 17 71273454 missense probably benign 0.12
R4176:Emilin2 UTSW 17 71274263 missense probably benign 0.00
R4348:Emilin2 UTSW 17 71280731 missense probably benign
R4352:Emilin2 UTSW 17 71280731 missense probably benign
R4695:Emilin2 UTSW 17 71252778 missense probably damaging 1.00
R4807:Emilin2 UTSW 17 71273448 missense probably damaging 0.98
R4980:Emilin2 UTSW 17 71253071 missense possibly damaging 0.79
R5028:Emilin2 UTSW 17 71274732 missense possibly damaging 0.91
R5048:Emilin2 UTSW 17 71273967 missense probably damaging 1.00
R5153:Emilin2 UTSW 17 71273502 missense possibly damaging 0.83
R5519:Emilin2 UTSW 17 71252935 missense probably benign 0.12
R5580:Emilin2 UTSW 17 71275230 missense probably benign
R6088:Emilin2 UTSW 17 71255124 missense probably benign
R6248:Emilin2 UTSW 17 71274117 missense probably benign 0.04
R6429:Emilin2 UTSW 17 71310956 start gained probably benign
R7085:Emilin2 UTSW 17 71274105 missense probably damaging 1.00
R7260:Emilin2 UTSW 17 71274790 missense probably benign 0.00
R7525:Emilin2 UTSW 17 71274979 missense probably benign
R7671:Emilin2 UTSW 17 71273910 missense probably benign 0.00
R7895:Emilin2 UTSW 17 71273913 missense probably benign 0.03
R8257:Emilin2 UTSW 17 71274000 missense probably benign
R8310:Emilin2 UTSW 17 71255146 missense probably damaging 1.00
R8311:Emilin2 UTSW 17 71255146 missense probably damaging 1.00
X0064:Emilin2 UTSW 17 71280703 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCCTTGGGAAACATGAACAGAGAC -3'
(R):5'- ATGTGGGTATCAGGAGCACAAAACC -3'

Sequencing Primer
(F):5'- ACATGAACAGAGACCATGTAGG -3'
(R):5'- AGCACAAAACCCAGGGAAG -3'
Posted On2014-02-18