Incidental Mutation 'R1302:Ifi207'
ID158401
Institutional Source Beutler Lab
Gene Symbol Ifi207
Ensembl Gene ENSMUSG00000073490
Gene Nameinterferon activated gene 207
SynonymsPyhin-A, AI607873
MMRRC Submission 039368-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1302 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173723427-173741747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 173735295 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 95 (L95Q)
Ref Sequence ENSEMBL: ENSMUSP00000119350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042610] [ENSMUST00000127730]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042610
AA Change: L95Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048129
Gene: ENSMUSG00000073490
AA Change: L95Q

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 162 N/A INTRINSIC
low complexity region 207 215 N/A INTRINSIC
internal_repeat_1 286 472 4.17e-7 PROSPERO
low complexity region 476 496 N/A INTRINSIC
internal_repeat_1 565 782 4.17e-7 PROSPERO
Pfam:HIN 788 954 4.9e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127730
AA Change: L95Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119350
Gene: ENSMUSG00000073490
AA Change: L95Q

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 155 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
internal_repeat_1 279 465 6.41e-7 PROSPERO
low complexity region 469 489 N/A INTRINSIC
internal_repeat_1 558 775 6.41e-7 PROSPERO
Pfam:HIN 781 948 1.8e-78 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik A T 8: 124,839,868 I271N probably damaging Het
5031439G07Rik A G 15: 84,953,276 Y279H probably damaging Het
Abcg2 T A 6: 58,685,817 M548K probably damaging Het
Acat1 T C 9: 53,589,225 D257G possibly damaging Het
Adamts4 G A 1: 171,253,183 G360R probably damaging Het
Akr1c12 T C 13: 4,272,329 D238G probably damaging Het
Ankrd1 C T 19: 36,115,003 G275S probably damaging Het
Ascc3 T A 10: 50,604,794 M1K probably null Het
Atf7ip2 T C 16: 10,240,608 S304P possibly damaging Het
Casp4 T A 9: 5,328,518 C333* probably null Het
Ccdc68 G A 18: 69,938,962 V37M probably damaging Het
Cda T A 4: 138,351,191 I87F probably damaging Het
Chst1 A T 2: 92,613,519 D112V probably damaging Het
Chtf18 T C 17: 25,719,158 D967G probably damaging Het
Col5a1 A G 2: 28,005,236 R1106G probably damaging Het
Coro1b T G 19: 4,149,377 F12V probably damaging Het
Ctif G T 18: 75,521,678 P259Q probably benign Het
Duox1 A T 2: 122,347,279 I1515F probably benign Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Flt1 A G 5: 147,564,240 Y1328H possibly damaging Het
Frem2 T C 3: 53,655,538 D516G probably benign Het
Gin1 A T 1: 97,775,589 K46* probably null Het
Gle1 C G 2: 29,952,552 probably null Het
Gm11146 T G 16: 77,602,082 I5L unknown Het
Gm597 A T 1: 28,776,340 D870E probably benign Het
Gpr153 C T 4: 152,279,943 T152M probably damaging Het
H1foo A T 6: 115,947,649 R39* probably null Het
Hdlbp A T 1: 93,423,385 probably null Het
Ikzf3 G T 11: 98,516,920 P32T probably benign Het
Ints10 T A 8: 68,827,312 V697E probably damaging Het
Krt14 A G 11: 100,203,347 S474P probably damaging Het
L3mbtl3 T A 10: 26,327,769 I388F unknown Het
Ldha A C 7: 46,847,639 Q7P probably damaging Het
Lrwd1 A G 5: 136,132,413 S232P probably benign Het
Med1 G T 11: 98,157,449 D840E possibly damaging Het
Med23 T A 10: 24,888,422 probably null Het
Naip5 G A 13: 100,221,591 P1046S possibly damaging Het
Ndufa4l2 A T 10: 127,515,432 M31L probably benign Het
Nlrp4f A G 13: 65,194,557 S425P possibly damaging Het
Nova1 A T 12: 46,720,798 H113Q unknown Het
Npc1 T C 18: 12,195,085 K1056E probably benign Het
Nrbp1 A G 5: 31,249,889 H354R probably benign Het
Ogfod3 A G 11: 121,183,474 F250L probably damaging Het
Pclo A G 5: 14,681,633 D3383G unknown Het
Pde1b T A 15: 103,527,599 D457E probably benign Het
Pkd1 C G 17: 24,568,236 S581R probably benign Het
Pno1 T A 11: 17,204,545 Q212L probably benign Het
Polr3b C T 10: 84,632,486 P112L probably damaging Het
Pomk T A 8: 25,983,074 I284F probably damaging Het
Rapgef4 A T 2: 72,045,160 D119V probably benign Het
Rprm A T 2: 54,085,153 L51Q probably benign Het
Taok3 A C 5: 117,199,043 S58R possibly damaging Het
Tmprss9 T A 10: 80,895,129 S830T probably benign Het
Tnfrsf1a G A 6: 125,356,916 C44Y probably damaging Het
Ubr5 A T 15: 38,041,479 D235E possibly damaging Het
Vapb C A 2: 173,771,537 F76L possibly damaging Het
Vmn2r72 T C 7: 85,738,257 I700V probably damaging Het
Wwc1 G A 11: 35,844,157 R964W probably damaging Het
Zfp644 A T 5: 106,634,899 V1203D probably damaging Het
Other mutations in Ifi207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Ifi207 APN 1 173725044 missense probably damaging 1.00
IGL01864:Ifi207 APN 1 173736441 missense possibly damaging 0.72
IGL02293:Ifi207 APN 1 173723748 missense probably damaging 1.00
IGL02402:Ifi207 APN 1 173727593 missense probably damaging 1.00
IGL03160:Ifi207 APN 1 173735104 splice site probably benign
PIT4458001:Ifi207 UTSW 1 173735172 missense unknown
R0043:Ifi207 UTSW 1 173729112 missense possibly damaging 0.48
R0212:Ifi207 UTSW 1 173736398 missense possibly damaging 0.85
R0395:Ifi207 UTSW 1 173729865 missense possibly damaging 0.85
R0506:Ifi207 UTSW 1 173736312 missense possibly damaging 0.52
R0843:Ifi207 UTSW 1 173727577 missense probably damaging 1.00
R1373:Ifi207 UTSW 1 173730347 missense unknown
R1462:Ifi207 UTSW 1 173724947 missense probably damaging 1.00
R1462:Ifi207 UTSW 1 173724947 missense probably damaging 1.00
R1471:Ifi207 UTSW 1 173730063 missense unknown
R1502:Ifi207 UTSW 1 173729306 missense possibly damaging 0.56
R1533:Ifi207 UTSW 1 173727740 missense probably benign 0.30
R1831:Ifi207 UTSW 1 173732426 missense unknown
R1928:Ifi207 UTSW 1 173729645 missense possibly damaging 0.68
R1982:Ifi207 UTSW 1 173735239 missense probably benign 0.01
R2132:Ifi207 UTSW 1 173729771 missense possibly damaging 0.84
R2248:Ifi207 UTSW 1 173736470 splice site probably benign
R3703:Ifi207 UTSW 1 173727463 nonsense probably null
R3741:Ifi207 UTSW 1 173727562 missense probably damaging 1.00
R3846:Ifi207 UTSW 1 173735303 missense probably benign 0.33
R4747:Ifi207 UTSW 1 173729067 missense probably benign 0.00
R4772:Ifi207 UTSW 1 173727687 missense probably damaging 1.00
R4776:Ifi207 UTSW 1 173730056 missense unknown
R4855:Ifi207 UTSW 1 173729815 missense probably damaging 0.96
R5170:Ifi207 UTSW 1 173730498 missense unknown
R5244:Ifi207 UTSW 1 173729937 missense probably benign 0.04
R5280:Ifi207 UTSW 1 173730304 missense unknown
R5301:Ifi207 UTSW 1 173729411 missense possibly damaging 0.83
R5334:Ifi207 UTSW 1 173727531 missense probably benign 0.21
R5445:Ifi207 UTSW 1 173727797 missense probably damaging 0.99
R5691:Ifi207 UTSW 1 173732426 missense unknown
R5838:Ifi207 UTSW 1 173732387 missense unknown
R6060:Ifi207 UTSW 1 173730527 missense unknown
R6220:Ifi207 UTSW 1 173729546 missense probably damaging 0.99
R6264:Ifi207 UTSW 1 173727545 missense probably damaging 1.00
R6307:Ifi207 UTSW 1 173725053 missense probably damaging 1.00
R6326:Ifi207 UTSW 1 173729966 missense probably benign 0.01
R6394:Ifi207 UTSW 1 173729015 missense probably benign 0.43
R6532:Ifi207 UTSW 1 173729645 missense possibly damaging 0.68
R6660:Ifi207 UTSW 1 173729406 missense probably benign 0.01
R6893:Ifi207 UTSW 1 173727642 missense possibly damaging 0.95
R7190:Ifi207 UTSW 1 173730252 missense unknown
R7192:Ifi207 UTSW 1 173729018 missense not run
R7194:Ifi207 UTSW 1 173729924 missense possibly damaging 0.84
R7327:Ifi207 UTSW 1 173729015 missense probably benign 0.43
R7348:Ifi207 UTSW 1 173729196 small deletion probably benign
R7404:Ifi207 UTSW 1 173728928 missense possibly damaging 0.92
R7442:Ifi207 UTSW 1 173727431 missense probably benign 0.03
R7500:Ifi207 UTSW 1 173729196 small deletion probably benign
X0003:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0004:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0005:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0009:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0010:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0011:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0012:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0013:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0014:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0017:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0018:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0019:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0020:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0021:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0022:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0023:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0024:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0025:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0026:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0027:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0028:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0033:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0034:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0035:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0036:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0037:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0038:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0039:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0040:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0050:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0052:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0053:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0054:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0057:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0058:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0060:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0061:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0062:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0063:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0064:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0065:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0066:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0067:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGAGGAATCACCTCTGCCTGTCTGC -3'
(R):5'- GACTGAGATACATGGGCTTCAAGAGCA -3'

Sequencing Primer
(F):5'- CTCACCTGGGCTGTAGAAG -3'
(R):5'- TTAGAGTTGTGTTGCTAGAGTAAAC -3'
Posted On2014-02-18