Mutagenetix > Incidental Mutations

Incidental Mutation 'R1302:Flt1'

158418

Institutional Source

Beutler Lab

Gene Symbol

Flt1

Ensembl Gene

ENSMUSG00000029648

Gene Name

FMS-like tyrosine kinase 1

Synonyms

Flt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1

MMRRC Submission

039368-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1302 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

147561604-147726011 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 147564240 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1328 (Y1328H)

Ref Sequence

ENSEMBL: ENSMUSP00000031653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031653]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031653
AA Change: Y1328H

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: Y1328H

Domain	Start	End	E-Value	Type
IG	38	130	1.74e-3	SMART
IG	144	225	1.49e-2	SMART
IG	238	330	2.23e-10	SMART
IG	345	426	2.43e-2	SMART
IG	440	554	2.6e-2	SMART
IGc2	569	644	1.76e-8	SMART
IGc2	674	739	6.29e-19	SMART
low complexity region	769	786	N/A	INTRINSIC
TyrKc	828	1154	9.54e-144	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.3%
20x: 86.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810004N23Rik	A	T	8: 124,839,868	I271N	probably damaging	Het
5031439G07Rik	A	G	15: 84,953,276	Y279H	probably damaging	Het
Abcg2	T	A	6: 58,685,817	M548K	probably damaging	Het
Acat1	T	C	9: 53,589,225	D257G	possibly damaging	Het
Adamts4	G	A	1: 171,253,183	G360R	probably damaging	Het
Akr1c12	T	C	13: 4,272,329	D238G	probably damaging	Het
Ankrd1	C	T	19: 36,115,003	G275S	probably damaging	Het
Ascc3	T	A	10: 50,604,794	M1K	probably null	Het
Atf7ip2	T	C	16: 10,240,608	S304P	possibly damaging	Het
Casp4	T	A	9: 5,328,518	C333*	probably null	Het
Ccdc68	G	A	18: 69,938,962	V37M	probably damaging	Het
Cda	T	A	4: 138,351,191	I87F	probably damaging	Het
Chst1	A	T	2: 92,613,519	D112V	probably damaging	Het
Chtf18	T	C	17: 25,719,158	D967G	probably damaging	Het
Col5a1	A	G	2: 28,005,236	R1106G	probably damaging	Het
Coro1b	T	G	19: 4,149,377	F12V	probably damaging	Het
Ctif	G	T	18: 75,521,678	P259Q	probably benign	Het
Duox1	A	T	2: 122,347,279	I1515F	probably benign	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Frem2	T	C	3: 53,655,538	D516G	probably benign	Het
Gin1	A	T	1: 97,775,589	K46*	probably null	Het
Gle1	C	G	2: 29,952,552		probably null	Het
Gm11146	T	G	16: 77,602,082	I5L	unknown	Het
Gm597	A	T	1: 28,776,340	D870E	probably benign	Het
Gpr153	C	T	4: 152,279,943	T152M	probably damaging	Het
H1foo	A	T	6: 115,947,649	R39*	probably null	Het
Hdlbp	A	T	1: 93,423,385		probably null	Het
Ifi207	A	T	1: 173,735,295	L95Q	possibly damaging	Het
Ikzf3	G	T	11: 98,516,920	P32T	probably benign	Het
Ints10	T	A	8: 68,827,312	V697E	probably damaging	Het
Krt14	A	G	11: 100,203,347	S474P	probably damaging	Het
L3mbtl3	T	A	10: 26,327,769	I388F	unknown	Het
Ldha	A	C	7: 46,847,639	Q7P	probably damaging	Het
Lrwd1	A	G	5: 136,132,413	S232P	probably benign	Het
Med1	G	T	11: 98,157,449	D840E	possibly damaging	Het
Med23	T	A	10: 24,888,422		probably null	Het
Naip5	G	A	13: 100,221,591	P1046S	possibly damaging	Het
Ndufa4l2	A	T	10: 127,515,432	M31L	probably benign	Het
Nlrp4f	A	G	13: 65,194,557	S425P	possibly damaging	Het
Nova1	A	T	12: 46,720,798	H113Q	unknown	Het
Npc1	T	C	18: 12,195,085	K1056E	probably benign	Het
Nrbp1	A	G	5: 31,249,889	H354R	probably benign	Het
Ogfod3	A	G	11: 121,183,474	F250L	probably damaging	Het
Pclo	A	G	5: 14,681,633	D3383G	unknown	Het
Pde1b	T	A	15: 103,527,599	D457E	probably benign	Het
Pkd1	C	G	17: 24,568,236	S581R	probably benign	Het
Pno1	T	A	11: 17,204,545	Q212L	probably benign	Het
Polr3b	C	T	10: 84,632,486	P112L	probably damaging	Het
Pomk	T	A	8: 25,983,074	I284F	probably damaging	Het
Rapgef4	A	T	2: 72,045,160	D119V	probably benign	Het
Rprm	A	T	2: 54,085,153	L51Q	probably benign	Het
Taok3	A	C	5: 117,199,043	S58R	possibly damaging	Het
Tmprss9	T	A	10: 80,895,129	S830T	probably benign	Het
Tnfrsf1a	G	A	6: 125,356,916	C44Y	probably damaging	Het
Ubr5	A	T	15: 38,041,479	D235E	possibly damaging	Het
Vapb	C	A	2: 173,771,537	F76L	possibly damaging	Het
Vmn2r72	T	C	7: 85,738,257	I700V	probably damaging	Het
Wwc1	G	A	11: 35,844,157	R964W	probably damaging	Het
Zfp644	A	T	5: 106,634,899	V1203D	probably damaging	Het

Other mutations in Flt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Flt1	APN	5	147580300	critical splice donor site	probably null
IGL00469:Flt1	APN	5	147603605	missense	probably damaging	0.99
IGL00897:Flt1	APN	5	147589854	missense	probably benign	0.25
IGL01111:Flt1	APN	5	147578336	missense	probably damaging	1.00
IGL01154:Flt1	APN	5	147576156	missense	possibly damaging	0.63
IGL01744:Flt1	APN	5	147571461	missense	probably benign	0.01
IGL01973:Flt1	APN	5	147683889	missense	probably benign	0.01
IGL02079:Flt1	APN	5	147568831	splice site	probably benign
IGL02143:Flt1	APN	5	147578436	missense	probably benign	0.00
IGL02156:Flt1	APN	5	147681741	missense	probably damaging	0.99
IGL02345:Flt1	APN	5	147582626	missense	probably benign	0.20
IGL02548:Flt1	APN	5	147639248	missense	probably benign	0.00
IGL02631:Flt1	APN	5	147673574	nonsense	probably null
IGL02686:Flt1	APN	5	147588602	missense	probably damaging	1.00
IGL02938:Flt1	APN	5	147678299	missense	possibly damaging	0.47
IGL03057:Flt1	APN	5	147681924	nonsense	probably null
IGL03196:Flt1	APN	5	147615127	critical splice donor site	probably null
IGL03205:Flt1	APN	5	147699821	missense	probably benign	0.00
IGL03255:Flt1	APN	5	147588521	splice site	probably benign
flywheels	UTSW	5	147599646	missense	probably damaging	1.00
BB008:Flt1	UTSW	5	147588572	missense	probably damaging	1.00
BB018:Flt1	UTSW	5	147588572	missense	probably damaging	1.00
IGL02837:Flt1	UTSW	5	147655170	missense	probably benign	0.32
PIT4402001:Flt1	UTSW	5	147678239	missense	probably damaging	1.00
R0013:Flt1	UTSW	5	147571014	splice site	probably benign
R0380:Flt1	UTSW	5	147588572	missense	probably damaging	1.00
R0448:Flt1	UTSW	5	147566394	splice site	probably benign
R0789:Flt1	UTSW	5	147639483	missense	probably damaging	1.00
R1005:Flt1	UTSW	5	147681885	missense	probably damaging	0.99
R1241:Flt1	UTSW	5	147599646	missense	probably damaging	1.00
R1411:Flt1	UTSW	5	147580316	missense	probably damaging	1.00
R1615:Flt1	UTSW	5	147639288	missense	probably damaging	1.00
R1634:Flt1	UTSW	5	147676430	missense	probably damaging	1.00
R1749:Flt1	UTSW	5	147655119	missense	probably benign	0.00
R1768:Flt1	UTSW	5	147672709	missense	probably damaging	1.00
R1972:Flt1	UTSW	5	147655093	splice site	probably benign
R2074:Flt1	UTSW	5	147599606	missense	possibly damaging	0.82
R2081:Flt1	UTSW	5	147639422	missense	probably damaging	1.00
R2864:Flt1	UTSW	5	147594621	missense	possibly damaging	0.68
R2865:Flt1	UTSW	5	147594621	missense	possibly damaging	0.68
R3740:Flt1	UTSW	5	147599593	missense	probably damaging	1.00
R3820:Flt1	UTSW	5	147700017	splice site	probably benign
R4089:Flt1	UTSW	5	147564241	missense	probably benign	0.03
R4299:Flt1	UTSW	5	147683907	missense	probably benign	0.00
R4570:Flt1	UTSW	5	147594613	missense	probably damaging	1.00
R4812:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4853:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4865:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4900:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4906:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4907:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R4909:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R5072:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R5073:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R5074:Flt1	UTSW	5	147683939	missense	probably benign	0.30
R5218:Flt1	UTSW	5	147681928	missense	probably damaging	1.00
R5547:Flt1	UTSW	5	147655138	missense	probably damaging	1.00
R5731:Flt1	UTSW	5	147678152	missense	probably benign	0.16
R5732:Flt1	UTSW	5	147634483	nonsense	probably null
R5804:Flt1	UTSW	5	147580437	splice site	probably null
R6107:Flt1	UTSW	5	147603593	missense	probably benign	0.15
R6440:Flt1	UTSW	5	147564305	missense	possibly damaging	0.79
R6453:Flt1	UTSW	5	147683941	missense	possibly damaging	0.80
R6539:Flt1	UTSW	5	147578376	missense	probably benign	0.27
R7068:Flt1	UTSW	5	147673634	missense	probably damaging	1.00
R7112:Flt1	UTSW	5	147603569	missense	probably damaging	1.00
R7195:Flt1	UTSW	5	147603576	missense	probably damaging	1.00
R7255:Flt1	UTSW	5	147580406	missense	probably damaging	1.00
R7347:Flt1	UTSW	5	147580381	missense	probably damaging	1.00
R7469:Flt1	UTSW	5	147603569	missense	probably damaging	1.00
R7473:Flt1	UTSW	5	147594595	missense	probably damaging	1.00
R7663:Flt1	UTSW	5	147655120	missense	probably benign
R7688:Flt1	UTSW	5	147676325	missense	probably benign
R7729:Flt1	UTSW	5	147700367	missense	probably benign	0.00
R7931:Flt1	UTSW	5	147588572	missense	probably damaging	1.00
R8051:Flt1	UTSW	5	147582691	missense	probably benign	0.02
R8275:Flt1	UTSW	5	147678147	missense	probably damaging	0.99
R8434:Flt1	UTSW	5	147639443	missense	probably damaging	0.97
R8442:Flt1	UTSW	5	147576173	missense	probably damaging	1.00
X0064:Flt1	UTSW	5	147673613	missense	probably damaging	1.00
Z1088:Flt1	UTSW	5	147681649	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- GCAGCCATGAGCTAATGGGCTTAC -3'
(R):5'- ACATCAGGGAGGCGTTTGATGGAC -3'

Sequencing Primer
(F):5'- ACGTCACTAACTGGGGTTAC -3'
(R):5'- GATGGACTGTTTCTCTTTCTCTTTAG -3'

Posted On

2014-02-18