Incidental Mutation 'R1302:Ldha'
ID158422
Institutional Source Beutler Lab
Gene Symbol Ldha
Ensembl Gene ENSMUSG00000063229
Gene Namelactate dehydrogenase A
Synonymsl7R2, Ldh-1, LDH-A, lactate dehydrogenase-A, Ldh1
MMRRC Submission 039368-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1302 (G1)
Quality Score212
Status Not validated
Chromosome7
Chromosomal Location46841475-46855627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 46847639 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 7 (Q7P)
Ref Sequence ENSEMBL: ENSMUSP00000147825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005051] [ENSMUST00000048209] [ENSMUST00000092621] [ENSMUST00000125862] [ENSMUST00000132157] [ENSMUST00000133062] [ENSMUST00000147535] [ENSMUST00000209548] [ENSMUST00000209984] [ENSMUST00000210467] [ENSMUST00000210631] [ENSMUST00000210815] [ENSMUST00000210968]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005051
AA Change: Q7P

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103267
Gene: ENSMUSG00000063229
AA Change: Q7P

DomainStartEndE-ValueType
Pfam:Ldh_1_N 50 189 2.5e-52 PFAM
Pfam:Ldh_1_C 192 360 2.7e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000048209
AA Change: Q7P

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036386
Gene: ENSMUSG00000063229
AA Change: Q7P

DomainStartEndE-ValueType
Pfam:Ldh_1_N 21 160 3e-53 PFAM
Pfam:Ldh_1_C 163 331 1.2e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092621
AA Change: Q7P

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097661
Gene: ENSMUSG00000063229
AA Change: Q7P

DomainStartEndE-ValueType
Pfam:Ldh_1_N 21 160 3.9e-54 PFAM
Pfam:Ldh_1_C 163 237 3.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124696
Predicted Effect possibly damaging
Transcript: ENSMUST00000125862
AA Change: Q7P

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000132157
AA Change: Q7P

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect possibly damaging
Transcript: ENSMUST00000133062
AA Change: Q7P

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000147535
AA Change: Q7P

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123356
Gene: ENSMUSG00000063229
AA Change: Q7P

DomainStartEndE-ValueType
Pfam:Ldh_1_N 58 197 5.7e-54 PFAM
Pfam:Ldh_1_C 200 273 5.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209548
AA Change: Q7P

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209984
AA Change: Q36P

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210198
Predicted Effect possibly damaging
Transcript: ENSMUST00000210467
AA Change: Q7P

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000210631
AA Change: Q7P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210815
AA Change: Q7P

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000210968
AA Change: Q7P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene catalyzes the conversion of L-lactate and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. The protein is found predominantly in muscle tissue and belongs to the lactate dehydrogenase family. Mutations in this gene have been linked to hemolytic anemia and early postimplantation death in mice. Multiple transcript variants encoding different isoforms have been found for this gene. The mouse genome contains multiple pseudogenes of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for one chemically induced mutation exhibit severe hemolytic anemia with pronounced reticulocytosis and hyperbilirubinemia. Another mutation results in prenatal lethality in homozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik A T 8: 124,839,868 I271N probably damaging Het
5031439G07Rik A G 15: 84,953,276 Y279H probably damaging Het
Abcg2 T A 6: 58,685,817 M548K probably damaging Het
Acat1 T C 9: 53,589,225 D257G possibly damaging Het
Adamts4 G A 1: 171,253,183 G360R probably damaging Het
Akr1c12 T C 13: 4,272,329 D238G probably damaging Het
Ankrd1 C T 19: 36,115,003 G275S probably damaging Het
Ascc3 T A 10: 50,604,794 M1K probably null Het
Atf7ip2 T C 16: 10,240,608 S304P possibly damaging Het
Casp4 T A 9: 5,328,518 C333* probably null Het
Ccdc68 G A 18: 69,938,962 V37M probably damaging Het
Cda T A 4: 138,351,191 I87F probably damaging Het
Chst1 A T 2: 92,613,519 D112V probably damaging Het
Chtf18 T C 17: 25,719,158 D967G probably damaging Het
Col5a1 A G 2: 28,005,236 R1106G probably damaging Het
Coro1b T G 19: 4,149,377 F12V probably damaging Het
Ctif G T 18: 75,521,678 P259Q probably benign Het
Duox1 A T 2: 122,347,279 I1515F probably benign Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Flt1 A G 5: 147,564,240 Y1328H possibly damaging Het
Frem2 T C 3: 53,655,538 D516G probably benign Het
Gin1 A T 1: 97,775,589 K46* probably null Het
Gle1 C G 2: 29,952,552 probably null Het
Gm11146 T G 16: 77,602,082 I5L unknown Het
Gm597 A T 1: 28,776,340 D870E probably benign Het
Gpr153 C T 4: 152,279,943 T152M probably damaging Het
H1foo A T 6: 115,947,649 R39* probably null Het
Hdlbp A T 1: 93,423,385 probably null Het
Ifi207 A T 1: 173,735,295 L95Q possibly damaging Het
Ikzf3 G T 11: 98,516,920 P32T probably benign Het
Ints10 T A 8: 68,827,312 V697E probably damaging Het
Krt14 A G 11: 100,203,347 S474P probably damaging Het
L3mbtl3 T A 10: 26,327,769 I388F unknown Het
Lrwd1 A G 5: 136,132,413 S232P probably benign Het
Med1 G T 11: 98,157,449 D840E possibly damaging Het
Med23 T A 10: 24,888,422 probably null Het
Naip5 G A 13: 100,221,591 P1046S possibly damaging Het
Ndufa4l2 A T 10: 127,515,432 M31L probably benign Het
Nlrp4f A G 13: 65,194,557 S425P possibly damaging Het
Nova1 A T 12: 46,720,798 H113Q unknown Het
Npc1 T C 18: 12,195,085 K1056E probably benign Het
Nrbp1 A G 5: 31,249,889 H354R probably benign Het
Ogfod3 A G 11: 121,183,474 F250L probably damaging Het
Pclo A G 5: 14,681,633 D3383G unknown Het
Pde1b T A 15: 103,527,599 D457E probably benign Het
Pkd1 C G 17: 24,568,236 S581R probably benign Het
Pno1 T A 11: 17,204,545 Q212L probably benign Het
Polr3b C T 10: 84,632,486 P112L probably damaging Het
Pomk T A 8: 25,983,074 I284F probably damaging Het
Rapgef4 A T 2: 72,045,160 D119V probably benign Het
Rprm A T 2: 54,085,153 L51Q probably benign Het
Taok3 A C 5: 117,199,043 S58R possibly damaging Het
Tmprss9 T A 10: 80,895,129 S830T probably benign Het
Tnfrsf1a G A 6: 125,356,916 C44Y probably damaging Het
Ubr5 A T 15: 38,041,479 D235E possibly damaging Het
Vapb C A 2: 173,771,537 F76L possibly damaging Het
Vmn2r72 T C 7: 85,738,257 I700V probably damaging Het
Wwc1 G A 11: 35,844,157 R964W probably damaging Het
Zfp644 A T 5: 106,634,899 V1203D probably damaging Het
Other mutations in Ldha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Ldha APN 7 46850178 missense possibly damaging 0.79
IGL01993:Ldha APN 7 46855100 missense possibly damaging 0.73
IGL02814:Ldha APN 7 46850891 nonsense probably null
R0530:Ldha UTSW 7 46853993 missense probably damaging 0.99
R4948:Ldha UTSW 7 46847381 missense probably benign 0.00
R5327:Ldha UTSW 7 46854098 missense probably benign
R5413:Ldha UTSW 7 46850896 missense possibly damaging 0.54
R5543:Ldha UTSW 7 46850890 missense possibly damaging 0.94
R5763:Ldha UTSW 7 46847789 intron probably benign
R7232:Ldha UTSW 7 46850899 missense probably benign 0.31
R7660:Ldha UTSW 7 46850257 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCAAGGTGAGAGCCTTCCTGGTG -3'
(R):5'- ACAGATGACTGAGTGTGTGCAAACC -3'

Sequencing Primer
(F):5'- TTCCTGGTGAGAGCCAGAC -3'
(R):5'- CTGAGTGTGTGCAAACCTTGATAG -3'
Posted On2014-02-18