Mutagenetix > Incidental Mutations

Incidental Mutation 'R1302:Vmn2r72'

158423

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r72

Ensembl Gene

ENSMUSG00000051877

Gene Name

vomeronasal 2, receptor 72

Synonyms

Vmn2r72-ps, EG244114

MMRRC Submission

039368-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R1302 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85737784-85754981 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85738257 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 700 (I700V)

Ref Sequence

ENSEMBL: ENSMUSP00000133014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063425]

Predicted Effect

probably damaging
Transcript: ENSMUST00000063425
AA Change: I700V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: I700V

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	82	469	2.3e-28	PFAM
Pfam:NCD3G	512	564	1.2e-18	PFAM
Pfam:7tm_3	594	832	4e-53	PFAM

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.3%
20x: 86.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810004N23Rik	A	T	8: 124,839,868	I271N	probably damaging	Het
5031439G07Rik	A	G	15: 84,953,276	Y279H	probably damaging	Het
Abcg2	T	A	6: 58,685,817	M548K	probably damaging	Het
Acat1	T	C	9: 53,589,225	D257G	possibly damaging	Het
Adamts4	G	A	1: 171,253,183	G360R	probably damaging	Het
Akr1c12	T	C	13: 4,272,329	D238G	probably damaging	Het
Ankrd1	C	T	19: 36,115,003	G275S	probably damaging	Het
Ascc3	T	A	10: 50,604,794	M1K	probably null	Het
Atf7ip2	T	C	16: 10,240,608	S304P	possibly damaging	Het
Casp4	T	A	9: 5,328,518	C333*	probably null	Het
Ccdc68	G	A	18: 69,938,962	V37M	probably damaging	Het
Cda	T	A	4: 138,351,191	I87F	probably damaging	Het
Chst1	A	T	2: 92,613,519	D112V	probably damaging	Het
Chtf18	T	C	17: 25,719,158	D967G	probably damaging	Het
Col5a1	A	G	2: 28,005,236	R1106G	probably damaging	Het
Coro1b	T	G	19: 4,149,377	F12V	probably damaging	Het
Ctif	G	T	18: 75,521,678	P259Q	probably benign	Het
Duox1	A	T	2: 122,347,279	I1515F	probably benign	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Flt1	A	G	5: 147,564,240	Y1328H	possibly damaging	Het
Frem2	T	C	3: 53,655,538	D516G	probably benign	Het
Gin1	A	T	1: 97,775,589	K46*	probably null	Het
Gle1	C	G	2: 29,952,552		probably null	Het
Gm11146	T	G	16: 77,602,082	I5L	unknown	Het
Gm597	A	T	1: 28,776,340	D870E	probably benign	Het
Gpr153	C	T	4: 152,279,943	T152M	probably damaging	Het
H1foo	A	T	6: 115,947,649	R39*	probably null	Het
Hdlbp	A	T	1: 93,423,385		probably null	Het
Ifi207	A	T	1: 173,735,295	L95Q	possibly damaging	Het
Ikzf3	G	T	11: 98,516,920	P32T	probably benign	Het
Ints10	T	A	8: 68,827,312	V697E	probably damaging	Het
Krt14	A	G	11: 100,203,347	S474P	probably damaging	Het
L3mbtl3	T	A	10: 26,327,769	I388F	unknown	Het
Ldha	A	C	7: 46,847,639	Q7P	probably damaging	Het
Lrwd1	A	G	5: 136,132,413	S232P	probably benign	Het
Med1	G	T	11: 98,157,449	D840E	possibly damaging	Het
Med23	T	A	10: 24,888,422		probably null	Het
Naip5	G	A	13: 100,221,591	P1046S	possibly damaging	Het
Ndufa4l2	A	T	10: 127,515,432	M31L	probably benign	Het
Nlrp4f	A	G	13: 65,194,557	S425P	possibly damaging	Het
Nova1	A	T	12: 46,720,798	H113Q	unknown	Het
Npc1	T	C	18: 12,195,085	K1056E	probably benign	Het
Nrbp1	A	G	5: 31,249,889	H354R	probably benign	Het
Ogfod3	A	G	11: 121,183,474	F250L	probably damaging	Het
Pclo	A	G	5: 14,681,633	D3383G	unknown	Het
Pde1b	T	A	15: 103,527,599	D457E	probably benign	Het
Pkd1	C	G	17: 24,568,236	S581R	probably benign	Het
Pno1	T	A	11: 17,204,545	Q212L	probably benign	Het
Polr3b	C	T	10: 84,632,486	P112L	probably damaging	Het
Pomk	T	A	8: 25,983,074	I284F	probably damaging	Het
Rapgef4	A	T	2: 72,045,160	D119V	probably benign	Het
Rprm	A	T	2: 54,085,153	L51Q	probably benign	Het
Taok3	A	C	5: 117,199,043	S58R	possibly damaging	Het
Tmprss9	T	A	10: 80,895,129	S830T	probably benign	Het
Tnfrsf1a	G	A	6: 125,356,916	C44Y	probably damaging	Het
Ubr5	A	T	15: 38,041,479	D235E	possibly damaging	Het
Vapb	C	A	2: 173,771,537	F76L	possibly damaging	Het
Wwc1	G	A	11: 35,844,157	R964W	probably damaging	Het
Zfp644	A	T	5: 106,634,899	V1203D	probably damaging	Het

Other mutations in Vmn2r72

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00931:Vmn2r72	APN	7	85749646	missense	probably benign	0.01
IGL01019:Vmn2r72	APN	7	85738334	missense	probably benign	0.26
IGL01445:Vmn2r72	APN	7	85749646	missense	probably benign	0.06
IGL02076:Vmn2r72	APN	7	85738367	missense	probably damaging	1.00
IGL02082:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02086:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02089:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02125:Vmn2r72	APN	7	85750711	missense	probably benign	0.00
IGL02146:Vmn2r72	APN	7	85737962	missense	probably damaging	1.00
IGL02272:Vmn2r72	APN	7	85750693	missense	probably benign
IGL02514:Vmn2r72	APN	7	85738699	missense	possibly damaging	0.90
IGL02662:Vmn2r72	APN	7	85738183	missense	probably benign	0.26
IGL02697:Vmn2r72	APN	7	85738671	missense	probably benign	0.36
IGL02733:Vmn2r72	APN	7	85751813	missense	probably benign	0.05
IGL03070:Vmn2r72	APN	7	85752041	splice site	probably benign
IGL03150:Vmn2r72	APN	7	85751176	missense	probably damaging	1.00
IGL03159:Vmn2r72	APN	7	85754954	missense	probably benign	0.05
IGL03333:Vmn2r72	APN	7	85750867	missense	probably benign	0.10
R0081:Vmn2r72	UTSW	7	85751836	missense	probably benign	0.01
R0090:Vmn2r72	UTSW	7	85754876	missense	probably benign
R0655:Vmn2r72	UTSW	7	85738111	nonsense	probably null
R0778:Vmn2r72	UTSW	7	85749739	missense	probably benign	0.00
R1169:Vmn2r72	UTSW	7	85751309	missense	probably benign	0.01
R1172:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1173:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1175:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1248:Vmn2r72	UTSW	7	85749188	missense	probably benign	0.02
R1506:Vmn2r72	UTSW	7	85749211	missense	probably benign
R1632:Vmn2r72	UTSW	7	85751792	missense	probably benign	0.13
R1775:Vmn2r72	UTSW	7	85738170	missense	probably benign	0.01
R1962:Vmn2r72	UTSW	7	85749161	missense	probably benign	0.00
R2201:Vmn2r72	UTSW	7	85738236	missense	probably benign	0.12
R2290:Vmn2r72	UTSW	7	85738341	missense	probably damaging	1.00
R2327:Vmn2r72	UTSW	7	85738256	missense	probably damaging	1.00
R2424:Vmn2r72	UTSW	7	85750953	missense	probably damaging	1.00
R2655:Vmn2r72	UTSW	7	85751269	missense	possibly damaging	0.95
R2860:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2861:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2862:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R3009:Vmn2r72	UTSW	7	85749642	missense	probably benign	0.00
R3797:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3798:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3902:Vmn2r72	UTSW	7	85749735	missense	possibly damaging	0.52
R3959:Vmn2r72	UTSW	7	85751131	missense	probably benign	0.36
R3974:Vmn2r72	UTSW	7	85749809	missense	probably damaging	1.00
R4399:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4421:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4426:Vmn2r72	UTSW	7	85737828	nonsense	probably null
R4522:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4523:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4533:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4691:Vmn2r72	UTSW	7	85737911	nonsense	probably null
R4781:Vmn2r72	UTSW	7	85737861	missense	probably benign	0.14
R4863:Vmn2r72	UTSW	7	85750598	missense	possibly damaging	0.91
R4952:Vmn2r72	UTSW	7	85751109	missense	probably benign
R4991:Vmn2r72	UTSW	7	85751130	missense	probably damaging	0.99
R4995:Vmn2r72	UTSW	7	85738485	missense	probably damaging	1.00
R5095:Vmn2r72	UTSW	7	85737853	missense	probably damaging	0.98
R5174:Vmn2r72	UTSW	7	85737840	missense	probably benign	0.00
R5276:Vmn2r72	UTSW	7	85738254	missense	possibly damaging	0.90
R5395:Vmn2r72	UTSW	7	85750897	missense	possibly damaging	0.71
R5560:Vmn2r72	UTSW	7	85751942	missense	probably damaging	0.96
R5933:Vmn2r72	UTSW	7	85737850	missense	probably benign	0.05
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6354:Vmn2r72	UTSW	7	85750539	critical splice donor site	probably null
R6362:Vmn2r72	UTSW	7	85751174	missense	probably damaging	1.00
R6594:Vmn2r72	UTSW	7	85749684	missense	probably benign	0.32
R6794:Vmn2r72	UTSW	7	85737996	missense	probably damaging	1.00
R7113:Vmn2r72	UTSW	7	85749803	synonymous	probably null
R7189:Vmn2r72	UTSW	7	85754917	missense	probably benign	0.36
R7266:Vmn2r72	UTSW	7	85738274	nonsense	probably null
R7323:Vmn2r72	UTSW	7	85750563	missense	probably benign
R7426:Vmn2r72	UTSW	7	85751140	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCCTGCACTTGATGCCAAGATAC -3'
(R):5'- TGGTCATCCCACTACGGTCATCTG -3'

Sequencing Primer
(F):5'- CATTGAATGTATCAGGCAGGTTCC -3'
(R):5'- ACTACGGTCATCTGTATCCTGC -3'

Posted On

2014-02-18