Incidental Mutation 'R1302:Acat1'
ID158428
Institutional Source Beutler Lab
Gene Symbol Acat1
Ensembl Gene ENSMUSG00000032047
Gene Nameacetyl-Coenzyme A acetyltransferase 1
Synonyms6330585C21Rik, Acat
MMRRC Submission 039368-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R1302 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location53580522-53610382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53589225 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 257 (D257G)
Ref Sequence ENSEMBL: ENSMUSP00000034547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034547]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034547
AA Change: D257G

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034547
Gene: ENSMUSG00000032047
AA Change: D257G

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Pfam:Thiolase_N 39 296 3.7e-98 PFAM
Pfam:ketoacyl-synt 104 166 1.1e-8 PFAM
Pfam:Thiolase_C 303 423 1.5e-48 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrially localized enzyme that catalyzes the reversible formation of acetoacetyl-CoA from two molecules of acetyl-CoA. Defects in this gene are associated with 3-ketothiolase deficiency, an inborn error of isoleucine catabolism characterized by urinary excretion of 2-methyl-3-hydroxybutyric acid, 2-methylacetoacetic acid, tiglylglycine, and butanone. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik A T 8: 124,839,868 I271N probably damaging Het
5031439G07Rik A G 15: 84,953,276 Y279H probably damaging Het
Abcg2 T A 6: 58,685,817 M548K probably damaging Het
Adamts4 G A 1: 171,253,183 G360R probably damaging Het
Akr1c12 T C 13: 4,272,329 D238G probably damaging Het
Ankrd1 C T 19: 36,115,003 G275S probably damaging Het
Ascc3 T A 10: 50,604,794 M1K probably null Het
Atf7ip2 T C 16: 10,240,608 S304P possibly damaging Het
Casp4 T A 9: 5,328,518 C333* probably null Het
Ccdc68 G A 18: 69,938,962 V37M probably damaging Het
Cda T A 4: 138,351,191 I87F probably damaging Het
Chst1 A T 2: 92,613,519 D112V probably damaging Het
Chtf18 T C 17: 25,719,158 D967G probably damaging Het
Col5a1 A G 2: 28,005,236 R1106G probably damaging Het
Coro1b T G 19: 4,149,377 F12V probably damaging Het
Ctif G T 18: 75,521,678 P259Q probably benign Het
Duox1 A T 2: 122,347,279 I1515F probably benign Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Flt1 A G 5: 147,564,240 Y1328H possibly damaging Het
Frem2 T C 3: 53,655,538 D516G probably benign Het
Gin1 A T 1: 97,775,589 K46* probably null Het
Gle1 C G 2: 29,952,552 probably null Het
Gm11146 T G 16: 77,602,082 I5L unknown Het
Gm597 A T 1: 28,776,340 D870E probably benign Het
Gpr153 C T 4: 152,279,943 T152M probably damaging Het
H1foo A T 6: 115,947,649 R39* probably null Het
Hdlbp A T 1: 93,423,385 probably null Het
Ifi207 A T 1: 173,735,295 L95Q possibly damaging Het
Ikzf3 G T 11: 98,516,920 P32T probably benign Het
Ints10 T A 8: 68,827,312 V697E probably damaging Het
Krt14 A G 11: 100,203,347 S474P probably damaging Het
L3mbtl3 T A 10: 26,327,769 I388F unknown Het
Ldha A C 7: 46,847,639 Q7P probably damaging Het
Lrwd1 A G 5: 136,132,413 S232P probably benign Het
Med1 G T 11: 98,157,449 D840E possibly damaging Het
Med23 T A 10: 24,888,422 probably null Het
Naip5 G A 13: 100,221,591 P1046S possibly damaging Het
Ndufa4l2 A T 10: 127,515,432 M31L probably benign Het
Nlrp4f A G 13: 65,194,557 S425P possibly damaging Het
Nova1 A T 12: 46,720,798 H113Q unknown Het
Npc1 T C 18: 12,195,085 K1056E probably benign Het
Nrbp1 A G 5: 31,249,889 H354R probably benign Het
Ogfod3 A G 11: 121,183,474 F250L probably damaging Het
Pclo A G 5: 14,681,633 D3383G unknown Het
Pde1b T A 15: 103,527,599 D457E probably benign Het
Pkd1 C G 17: 24,568,236 S581R probably benign Het
Pno1 T A 11: 17,204,545 Q212L probably benign Het
Polr3b C T 10: 84,632,486 P112L probably damaging Het
Pomk T A 8: 25,983,074 I284F probably damaging Het
Rapgef4 A T 2: 72,045,160 D119V probably benign Het
Rprm A T 2: 54,085,153 L51Q probably benign Het
Taok3 A C 5: 117,199,043 S58R possibly damaging Het
Tmprss9 T A 10: 80,895,129 S830T probably benign Het
Tnfrsf1a G A 6: 125,356,916 C44Y probably damaging Het
Ubr5 A T 15: 38,041,479 D235E possibly damaging Het
Vapb C A 2: 173,771,537 F76L possibly damaging Het
Vmn2r72 T C 7: 85,738,257 I700V probably damaging Het
Wwc1 G A 11: 35,844,157 R964W probably damaging Het
Zfp644 A T 5: 106,634,899 V1203D probably damaging Het
Other mutations in Acat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Acat1 APN 9 53582595 missense probably damaging 0.98
IGL02160:Acat1 APN 9 53591987 missense probably benign 0.00
IGL02246:Acat1 APN 9 53584866 missense probably benign 0.06
IGL02582:Acat1 APN 9 53594745 missense probably benign 0.37
IGL03028:Acat1 APN 9 53594762 missense probably benign 0.14
R0637:Acat1 UTSW 9 53587531 missense probably damaging 1.00
R1200:Acat1 UTSW 9 53583510 missense possibly damaging 0.90
R1331:Acat1 UTSW 9 53584883 missense probably benign 0.10
R3683:Acat1 UTSW 9 53587465 missense probably damaging 1.00
R4829:Acat1 UTSW 9 53591456 missense probably damaging 1.00
R5035:Acat1 UTSW 9 53583510 missense probably benign 0.00
R5354:Acat1 UTSW 9 53589183 missense possibly damaging 0.91
R5411:Acat1 UTSW 9 53582646 missense probably damaging 1.00
R5521:Acat1 UTSW 9 53583507 nonsense probably null
R5634:Acat1 UTSW 9 53583621 intron probably benign
R5905:Acat1 UTSW 9 53592066 missense probably damaging 1.00
R6028:Acat1 UTSW 9 53592066 missense probably damaging 1.00
R6925:Acat1 UTSW 9 53592029 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CTGTGGAAAACAACTCTCTAGCCATGT -3'
(R):5'- CCCCAGGAGTACAGGCTGTGA -3'

Sequencing Primer
(F):5'- gatggcagttcacaattccag -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2014-02-18