Incidental Mutation 'R1302:Naip5'
ID 158450
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene Name NLR family, apoptosis inhibitory protein 5
Synonyms Birc1e, Lgn1, Naip-rs3
MMRRC Submission 039368-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R1302 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 100211739-100246323 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 100221591 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1046 (P1046S)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
AlphaFold Q9R016
Predicted Effect possibly damaging
Transcript: ENSMUST00000049789
AA Change: P1046S

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: P1046S

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.3%
  • 20x: 86.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik A T 8: 124,839,868 I271N probably damaging Het
5031439G07Rik A G 15: 84,953,276 Y279H probably damaging Het
Abcg2 T A 6: 58,685,817 M548K probably damaging Het
Acat1 T C 9: 53,589,225 D257G possibly damaging Het
Adamts4 G A 1: 171,253,183 G360R probably damaging Het
Akr1c12 T C 13: 4,272,329 D238G probably damaging Het
Ankrd1 C T 19: 36,115,003 G275S probably damaging Het
Ascc3 T A 10: 50,604,794 M1K probably null Het
Atf7ip2 T C 16: 10,240,608 S304P possibly damaging Het
Casp4 T A 9: 5,328,518 C333* probably null Het
Ccdc68 G A 18: 69,938,962 V37M probably damaging Het
Cda T A 4: 138,351,191 I87F probably damaging Het
Chst1 A T 2: 92,613,519 D112V probably damaging Het
Chtf18 T C 17: 25,719,158 D967G probably damaging Het
Col5a1 A G 2: 28,005,236 R1106G probably damaging Het
Coro1b T G 19: 4,149,377 F12V probably damaging Het
Ctif G T 18: 75,521,678 P259Q probably benign Het
Duox1 A T 2: 122,347,279 I1515F probably benign Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Flt1 A G 5: 147,564,240 Y1328H possibly damaging Het
Frem2 T C 3: 53,655,538 D516G probably benign Het
Gin1 A T 1: 97,775,589 K46* probably null Het
Gle1 C G 2: 29,952,552 probably null Het
Gm11146 T G 16: 77,602,082 I5L unknown Het
Gm597 A T 1: 28,776,340 D870E probably benign Het
Gpr153 C T 4: 152,279,943 T152M probably damaging Het
H1foo A T 6: 115,947,649 R39* probably null Het
Hdlbp A T 1: 93,423,385 probably null Het
Ifi207 A T 1: 173,735,295 L95Q possibly damaging Het
Ikzf3 G T 11: 98,516,920 P32T probably benign Het
Ints10 T A 8: 68,827,312 V697E probably damaging Het
Krt14 A G 11: 100,203,347 S474P probably damaging Het
L3mbtl3 T A 10: 26,327,769 I388F unknown Het
Ldha A C 7: 46,847,639 Q7P probably damaging Het
Lrwd1 A G 5: 136,132,413 S232P probably benign Het
Med1 G T 11: 98,157,449 D840E possibly damaging Het
Med23 T A 10: 24,888,422 probably null Het
Ndufa4l2 A T 10: 127,515,432 M31L probably benign Het
Nlrp4f A G 13: 65,194,557 S425P possibly damaging Het
Nova1 A T 12: 46,720,798 H113Q unknown Het
Npc1 T C 18: 12,195,085 K1056E probably benign Het
Nrbp1 A G 5: 31,249,889 H354R probably benign Het
Ogfod3 A G 11: 121,183,474 F250L probably damaging Het
Pclo A G 5: 14,681,633 D3383G unknown Het
Pde1b T A 15: 103,527,599 D457E probably benign Het
Pkd1 C G 17: 24,568,236 S581R probably benign Het
Pno1 T A 11: 17,204,545 Q212L probably benign Het
Polr3b C T 10: 84,632,486 P112L probably damaging Het
Pomk T A 8: 25,983,074 I284F probably damaging Het
Rapgef4 A T 2: 72,045,160 D119V probably benign Het
Rprm A T 2: 54,085,153 L51Q probably benign Het
Taok3 A C 5: 117,199,043 S58R possibly damaging Het
Tmprss9 T A 10: 80,895,129 S830T probably benign Het
Tnfrsf1a G A 6: 125,356,916 C44Y probably damaging Het
Ubr5 A T 15: 38,041,479 D235E possibly damaging Het
Vapb C A 2: 173,771,537 F76L possibly damaging Het
Vmn2r72 T C 7: 85,738,257 I700V probably damaging Het
Wwc1 G A 11: 35,844,157 R964W probably damaging Het
Zfp644 A T 5: 106,634,899 V1203D probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
Nuchal UTSW 13 100214663 missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
R7588:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7588:Naip5 UTSW 13 100219697 missense not run
R7589:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7589:Naip5 UTSW 13 100219697 missense not run
R7590:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7590:Naip5 UTSW 13 100219697 missense not run
R7742:Naip5 UTSW 13 100219830 missense probably benign
R7886:Naip5 UTSW 13 100246181 missense probably benign 0.28
R7996:Naip5 UTSW 13 100221656 missense probably damaging 1.00
R8026:Naip5 UTSW 13 100245898 missense probably damaging 1.00
R8046:Naip5 UTSW 13 100222233 missense probably benign
R8319:Naip5 UTSW 13 100221659 missense probably benign 0.12
R8471:Naip5 UTSW 13 100221645 missense probably damaging 0.99
R8480:Naip5 UTSW 13 100222235 missense probably damaging 1.00
R8496:Naip5 UTSW 13 100212739 missense probably benign 0.00
R8500:Naip5 UTSW 13 100222712 missense probably damaging 0.98
R8712:Naip5 UTSW 13 100223096 missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100219830 missense probably benign
R8781:Naip5 UTSW 13 100219830 missense probably benign
R8788:Naip5 UTSW 13 100219830 missense probably benign
R8817:Naip5 UTSW 13 100212699 missense probably benign 0.01
R8833:Naip5 UTSW 13 100222934 missense probably damaging 0.97
R8835:Naip5 UTSW 13 100219830 missense probably benign
R8958:Naip5 UTSW 13 100217609 nonsense probably null
R9031:Naip5 UTSW 13 100219830 missense probably benign
R9032:Naip5 UTSW 13 100219830 missense probably benign
R9074:Naip5 UTSW 13 100221756 missense possibly damaging 0.92
R9098:Naip5 UTSW 13 100229619 missense possibly damaging 0.67
R9204:Naip5 UTSW 13 100222500 missense probably damaging 1.00
R9223:Naip5 UTSW 13 100227676 missense probably benign 0.05
R9358:Naip5 UTSW 13 100219830 missense probably benign
R9389:Naip5 UTSW 13 100219830 missense probably benign
R9403:Naip5 UTSW 13 100219830 missense probably benign
R9518:Naip5 UTSW 13 100221859 missense probably benign
R9568:Naip5 UTSW 13 100219830 missense probably benign
R9568:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9569:Naip5 UTSW 13 100219830 missense probably benign
R9569:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9570:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9572:Naip5 UTSW 13 100223313 missense probably benign 0.00
R9581:Naip5 UTSW 13 100214686 missense probably benign 0.11
R9627:Naip5 UTSW 13 100219830 missense probably benign
R9725:Naip5 UTSW 13 100222276 missense possibly damaging 0.94
R9763:Naip5 UTSW 13 100230761 missense probably damaging 0.99
R9764:Naip5 UTSW 13 100230761 missense probably damaging 0.99
R9765:Naip5 UTSW 13 100230761 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCCTTGTGCCTGAGAAGTTCC -3'
(R):5'- AGAGCCCTACCAGACATCAGTGAAG -3'

Sequencing Primer
(F):5'- CTGAGAAGTTCCCTTCATGTAAAGC -3'
(R):5'- TGAAGGGTACTGGAAACTGTC -3'
Posted On 2014-02-18