Mutagenetix > Incidental Mutations

Incidental Mutation 'R1302:Naip5'

158450

Institutional Source

Beutler Lab

Gene Symbol

Naip5

Ensembl Gene

ENSMUSG00000071203

Gene Name

NLR family, apoptosis inhibitory protein 5

Synonyms

Birc1e, Lgn1, Naip-rs3

MMRRC Submission

039368-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R1302 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100211739-100246323 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 100221591 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1046 (P1046S)

Ref Sequence

ENSEMBL: ENSMUSP00000058611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049789]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049789
AA Change: P1046S

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: P1046S

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
BIR	58	129	1.08e-19	SMART
BIR	157	229	1.06e-36	SMART
BIR	276	347	2.14e-32	SMART
Pfam:NACHT	464	618	1.7e-36	PFAM
low complexity region	851	862	N/A	INTRINSIC

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 94.3%
20x: 86.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810004N23Rik	A	T	8: 124,839,868	I271N	probably damaging	Het
5031439G07Rik	A	G	15: 84,953,276	Y279H	probably damaging	Het
Abcg2	T	A	6: 58,685,817	M548K	probably damaging	Het
Acat1	T	C	9: 53,589,225	D257G	possibly damaging	Het
Adamts4	G	A	1: 171,253,183	G360R	probably damaging	Het
Akr1c12	T	C	13: 4,272,329	D238G	probably damaging	Het
Ankrd1	C	T	19: 36,115,003	G275S	probably damaging	Het
Ascc3	T	A	10: 50,604,794	M1K	probably null	Het
Atf7ip2	T	C	16: 10,240,608	S304P	possibly damaging	Het
Casp4	T	A	9: 5,328,518	C333*	probably null	Het
Ccdc68	G	A	18: 69,938,962	V37M	probably damaging	Het
Cda	T	A	4: 138,351,191	I87F	probably damaging	Het
Chst1	A	T	2: 92,613,519	D112V	probably damaging	Het
Chtf18	T	C	17: 25,719,158	D967G	probably damaging	Het
Col5a1	A	G	2: 28,005,236	R1106G	probably damaging	Het
Coro1b	T	G	19: 4,149,377	F12V	probably damaging	Het
Ctif	G	T	18: 75,521,678	P259Q	probably benign	Het
Duox1	A	T	2: 122,347,279	I1515F	probably benign	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Flt1	A	G	5: 147,564,240	Y1328H	possibly damaging	Het
Frem2	T	C	3: 53,655,538	D516G	probably benign	Het
Gin1	A	T	1: 97,775,589	K46*	probably null	Het
Gle1	C	G	2: 29,952,552		probably null	Het
Gm11146	T	G	16: 77,602,082	I5L	unknown	Het
Gm597	A	T	1: 28,776,340	D870E	probably benign	Het
Gpr153	C	T	4: 152,279,943	T152M	probably damaging	Het
H1foo	A	T	6: 115,947,649	R39*	probably null	Het
Hdlbp	A	T	1: 93,423,385		probably null	Het
Ifi207	A	T	1: 173,735,295	L95Q	possibly damaging	Het
Ikzf3	G	T	11: 98,516,920	P32T	probably benign	Het
Ints10	T	A	8: 68,827,312	V697E	probably damaging	Het
Krt14	A	G	11: 100,203,347	S474P	probably damaging	Het
L3mbtl3	T	A	10: 26,327,769	I388F	unknown	Het
Ldha	A	C	7: 46,847,639	Q7P	probably damaging	Het
Lrwd1	A	G	5: 136,132,413	S232P	probably benign	Het
Med1	G	T	11: 98,157,449	D840E	possibly damaging	Het
Med23	T	A	10: 24,888,422		probably null	Het
Ndufa4l2	A	T	10: 127,515,432	M31L	probably benign	Het
Nlrp4f	A	G	13: 65,194,557	S425P	possibly damaging	Het
Nova1	A	T	12: 46,720,798	H113Q	unknown	Het
Npc1	T	C	18: 12,195,085	K1056E	probably benign	Het
Nrbp1	A	G	5: 31,249,889	H354R	probably benign	Het
Ogfod3	A	G	11: 121,183,474	F250L	probably damaging	Het
Pclo	A	G	5: 14,681,633	D3383G	unknown	Het
Pde1b	T	A	15: 103,527,599	D457E	probably benign	Het
Pkd1	C	G	17: 24,568,236	S581R	probably benign	Het
Pno1	T	A	11: 17,204,545	Q212L	probably benign	Het
Polr3b	C	T	10: 84,632,486	P112L	probably damaging	Het
Pomk	T	A	8: 25,983,074	I284F	probably damaging	Het
Rapgef4	A	T	2: 72,045,160	D119V	probably benign	Het
Rprm	A	T	2: 54,085,153	L51Q	probably benign	Het
Taok3	A	C	5: 117,199,043	S58R	possibly damaging	Het
Tmprss9	T	A	10: 80,895,129	S830T	probably benign	Het
Tnfrsf1a	G	A	6: 125,356,916	C44Y	probably damaging	Het
Ubr5	A	T	15: 38,041,479	D235E	possibly damaging	Het
Vapb	C	A	2: 173,771,537	F76L	possibly damaging	Het
Vmn2r72	T	C	7: 85,738,257	I700V	probably damaging	Het
Wwc1	G	A	11: 35,844,157	R964W	probably damaging	Het
Zfp644	A	T	5: 106,634,899	V1203D	probably damaging	Het

Other mutations in Naip5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Naip5	APN	13	100246175	nonsense	probably null
IGL00493:Naip5	APN	13	100230771	missense	probably damaging	0.96
IGL01294:Naip5	APN	13	100217080	missense	probably damaging	0.99
IGL01405:Naip5	APN	13	100221945	missense	probably benign	0.11
IGL01568:Naip5	APN	13	100217101	missense	probably benign	0.26
IGL01804:Naip5	APN	13	100221584	missense	probably damaging	1.00
IGL02012:Naip5	APN	13	100223339	missense	probably benign	0.01
IGL02183:Naip5	APN	13	100221642	missense	probably benign	0.41
IGL02449:Naip5	APN	13	100222175	missense	probably benign	0.34
IGL02815:Naip5	APN	13	100222731	missense	probably benign
IGL02992:Naip5	APN	13	100223028	missense	probably damaging	1.00
IGL03027:Naip5	APN	13	100223016	missense	probably benign	0.00
IGL03234:Naip5	APN	13	100212627	missense	probably damaging	1.00
inwood2	UTSW	13	100223014	nonsense	probably null
inwood3	UTSW	13	100221903	nonsense	probably null
PIT4131001:Naip5	UTSW	13	100219739	missense	probably benign
PIT4131001:Naip5	UTSW	13	100219760	missense	probably benign	0.00
R0001:Naip5	UTSW	13	100214650	critical splice donor site	probably null
R0001:Naip5	UTSW	13	100223114	missense	probably benign
R0462:Naip5	UTSW	13	100221732	missense	probably damaging	1.00
R0636:Naip5	UTSW	13	100219688	missense	probably benign
R0674:Naip5	UTSW	13	100223199	missense	probably benign	0.04
R0764:Naip5	UTSW	13	100217105	missense	probably benign	0.03
R0837:Naip5	UTSW	13	100230743	missense	probably benign
R1179:Naip5	UTSW	13	100219830	missense	probably benign
R1441:Naip5	UTSW	13	100219717	missense	possibly damaging	0.95
R1513:Naip5	UTSW	13	100222206	missense	probably benign
R1638:Naip5	UTSW	13	100212669	missense	probably damaging	1.00
R1651:Naip5	UTSW	13	100221911	missense	probably benign	0.41
R1707:Naip5	UTSW	13	100242855	missense	probably damaging	1.00
R1835:Naip5	UTSW	13	100223218	nonsense	probably null
R1836:Naip5	UTSW	13	100219687	missense	probably benign	0.18
R1972:Naip5	UTSW	13	100212770	missense	probably damaging	0.98
R2080:Naip5	UTSW	13	100221533	missense	probably damaging	1.00
R2333:Naip5	UTSW	13	100223171	missense	probably damaging	1.00
R2348:Naip5	UTSW	13	100219738	missense	probably benign	0.01
R3055:Naip5	UTSW	13	100221878	missense	probably benign	0.23
R3401:Naip5	UTSW	13	100221903	nonsense	probably null
R3723:Naip5	UTSW	13	100223014	nonsense	probably null
R3775:Naip5	UTSW	13	100223375	missense	probably benign	0.00
R3775:Naip5	UTSW	13	100223394	missense	probably benign	0.00
R4019:Naip5	UTSW	13	100223375	missense	probably benign	0.00
R4019:Naip5	UTSW	13	100223394	missense	probably benign	0.00
R4020:Naip5	UTSW	13	100223375	missense	probably benign	0.00
R4020:Naip5	UTSW	13	100223394	missense	probably benign	0.00
R4074:Naip5	UTSW	13	100246064	missense	probably damaging	1.00
R4082:Naip5	UTSW	13	100245830	missense	probably damaging	1.00
R4105:Naip5	UTSW	13	100219739	missense	probably benign
R4227:Naip5	UTSW	13	100212768	missense	probably damaging	0.99
R4639:Naip5	UTSW	13	100219830	missense	probably benign
R4640:Naip5	UTSW	13	100219830	missense	probably benign
R4641:Naip5	UTSW	13	100219830	missense	probably benign
R4644:Naip5	UTSW	13	100219830	missense	probably benign
R4645:Naip5	UTSW	13	100219830	missense	probably benign
R4700:Naip5	UTSW	13	100223414	missense	possibly damaging	0.62
R4727:Naip5	UTSW	13	100221870	missense	possibly damaging	0.81
R4729:Naip5	UTSW	13	100222131	missense	possibly damaging	0.75
R4816:Naip5	UTSW	13	100219681	missense	probably benign	0.32
R4816:Naip5	UTSW	13	100219687	missense	probably benign	0.01
R4816:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R4869:Naip5	UTSW	13	100245131	missense	probably damaging	1.00
R5162:Naip5	UTSW	13	100223406	missense	possibly damaging	0.78
R5244:Naip5	UTSW	13	100245662	missense	probably benign	0.08
R5411:Naip5	UTSW	13	100245746	missense	possibly damaging	0.54
R5632:Naip5	UTSW	13	100230662	splice site	probably null
R5760:Naip5	UTSW	13	100242838	missense	probably damaging	1.00
R5916:Naip5	UTSW	13	100222701	missense	probably benign	0.02
R6302:Naip5	UTSW	13	100223166	missense	possibly damaging	0.76
R6304:Naip5	UTSW	13	100223166	missense	possibly damaging	0.76
R6411:Naip5	UTSW	13	100223405	missense	probably benign	0.01
R6474:Naip5	UTSW	13	100214663	missense	possibly damaging	0.82
R6499:Naip5	UTSW	13	100221594	missense	probably benign
R6544:Naip5	UTSW	13	100223144	missense	possibly damaging	0.50
R6827:Naip5	UTSW	13	100245929	missense	possibly damaging	0.48
R6954:Naip5	UTSW	13	100223414	missense	probably damaging	0.99
R7052:Naip5	UTSW	13	100222347	missense	probably benign	0.01
R7138:Naip5	UTSW	13	100219830	missense	probably benign
R7141:Naip5	UTSW	13	100219830	missense	probably benign
R7375:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7375:Naip5	UTSW	13	100219697	missense	not run
R7401:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7401:Naip5	UTSW	13	100219697	missense	not run
R7447:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7447:Naip5	UTSW	13	100219697	missense	not run
R7466:Naip5	UTSW	13	100221986	nonsense	probably null
R7491:Naip5	UTSW	13	100217071	missense	probably benign	0.18
R7559:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7559:Naip5	UTSW	13	100219697	missense	not run
R7562:Naip5	UTSW	13	100219696	missense	probably benign	0.00
R7562:Naip5	UTSW	13	100219697	missense	not run

Predicted Primers

PCR Primer
(F):5'- ATGGCCTTGTGCCTGAGAAGTTCC -3'
(R):5'- AGAGCCCTACCAGACATCAGTGAAG -3'

Sequencing Primer
(F):5'- CTGAGAAGTTCCCTTCATGTAAAGC -3'
(R):5'- TGAAGGGTACTGGAAACTGTC -3'

Posted On

2014-02-18