Mutagenetix > Incidental Mutation

Incidental Mutation 'R0510:Sptbn4'

158482

Institutional Source

Beutler Lab

Gene Symbol

Sptbn4

Ensembl Gene

ENSMUSG00000011751

Gene Name

spectrin beta, non-erythrocytic 4

Synonyms

ROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4

MMRRC Submission

038704-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.382) question?

Stock #

R0510 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

27356383-27447686 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 27361566 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000132807 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]

AlphaFold

E9PX29

Predicted Effect

probably null
Transcript: ENSMUST00000011895

SMART Domains

Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.4e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	642	7.62e-19	SMART
SPEC	648	766	1.31e-8	SMART
SPEC	772	874	2.94e-11	SMART
SPEC	880	980	1.49e-21	SMART
SPEC	986	1081	1.65e0	SMART
SPEC	1087	1192	2.82e-13	SMART
SPEC	1198	1298	6.59e-14	SMART
SPEC	1304	1403	4.08e-19	SMART
SPEC	1409	1508	5.92e-7	SMART
SPEC	1514	1614	2.45e-22	SMART
SPEC	1620	1720	1.45e-24	SMART
SPEC	1726	1827	1.86e-22	SMART
SPEC	1833	1935	9.54e-11	SMART
SPEC	1941	2041	1.35e-19	SMART
SPEC	2047	2297	1.06e-8	SMART
low complexity region	2358	2412	N/A	INTRINSIC
PH	2416	2526	1.54e-14	SMART
low complexity region	2549	2560	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108362

SMART Domains

Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108363

SMART Domains

Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108364

SMART Domains

Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126587

Predicted Effect

probably null
Transcript: ENSMUST00000172269

SMART Domains

Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.9e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	637	3.45e-17	SMART
SPEC	643	761	1.31e-8	SMART
SPEC	767	869	2.94e-11	SMART
SPEC	875	975	1.49e-21	SMART
SPEC	981	1076	1.65e0	SMART
SPEC	1082	1187	2.82e-13	SMART
SPEC	1193	1293	6.59e-14	SMART
SPEC	1299	1398	4.08e-19	SMART
SPEC	1404	1503	5.92e-7	SMART
SPEC	1509	1609	2.45e-22	SMART
SPEC	1615	1715	1.45e-24	SMART
SPEC	1721	1822	1.86e-22	SMART
SPEC	1828	1930	9.54e-11	SMART
SPEC	1936	2036	1.35e-19	SMART
SPEC	2042	2292	1.06e-8	SMART
low complexity region	2352	2406	N/A	INTRINSIC
PH	2410	2520	1.54e-14	SMART
low complexity region	2543	2554	N/A	INTRINSIC

Meta Mutation Damage Score

0.9504

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

99% (102/103)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933408B17Rik	A	T	18: 34,596,151	D42E	probably damaging	Het
Abcg3	A	G	5: 104,977,616	I67T	probably damaging	Het
Acoxl	G	A	2: 127,880,503		probably null	Het
Adam10	T	A	9: 70,748,248	W333R	probably damaging	Het
Ahnak	C	T	19: 9,018,232	R5627*	probably null	Het
Alms1	A	T	6: 85,620,369	R1195*	probably null	Het
Ap2m1	T	A	16: 20,542,240	I334N	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Ccdc110	T	A	8: 45,935,157	N50K	probably benign	Het
Cdhr1	T	C	14: 37,080,676	Y610C	probably damaging	Het
Cdkal1	C	A	13: 29,691,596		probably null	Het
Celsr3	G	A	9: 108,827,005	C229Y	possibly damaging	Het
Clca4b	A	T	3: 144,913,351	Y676N	probably damaging	Het
Col11a1	A	T	3: 114,105,456		probably benign	Het
Cpe	T	A	8: 64,611,467	I233F	probably damaging	Het
Cpsf1	A	T	15: 76,603,657		probably benign	Het
Cpsf2	T	C	12: 101,988,786	V272A	probably damaging	Het
Creld2	A	T	15: 88,819,956	N50I	probably damaging	Het
Cyb5r1	T	C	1: 134,409,692		probably benign	Het
Dcaf11	T	C	14: 55,569,080	V446A	probably damaging	Het
Defa34	A	G	8: 21,665,972		probably null	Het
Dgat1	T	C	15: 76,511,567	Y72C	possibly damaging	Het
Efr3b	G	T	12: 3,982,058	D183E	probably benign	Het
Enpp3	A	T	10: 24,776,781	D759E	probably damaging	Het
Epyc	A	G	10: 97,649,763	T22A	probably benign	Het
Etfbkmt	C	T	6: 149,150,584	R96W	probably benign	Het
Fam83b	G	T	9: 76,492,826	L332I	possibly damaging	Het
Fat3	C	A	9: 15,999,685	E1674*	probably null	Het
Fbn1	A	G	2: 125,342,925		probably benign	Het
Gm5134	C	A	10: 75,974,245	T120N	probably benign	Het
Gm5415	T	A	1: 32,545,875	N318I	possibly damaging	Het
Gm8251	T	A	1: 44,061,097	K280N	possibly damaging	Het
Gmip	C	T	8: 69,815,609		probably benign	Het
Gpbp1	G	T	13: 111,440,745	Q204K	possibly damaging	Het
Gpr108	T	C	17: 57,235,358	D549G	possibly damaging	Het
Gsdme	C	A	6: 50,246,127		probably benign	Het
Gucy2e	T	C	11: 69,235,576	D326G	probably benign	Het
H2-Eb2	C	T	17: 34,334,244	Q135*	probably null	Het
Hectd4	T	A	5: 121,281,896	Y635N	possibly damaging	Het
Hectd4	G	A	5: 121,305,673	E1319K	possibly damaging	Het
Hs3st2	T	C	7: 121,500,569	S213P	probably damaging	Het
Ikbkb	A	T	8: 22,671,635	C412*	probably null	Het
Itpr2	T	C	6: 146,417,979	T188A	possibly damaging	Het
Kcnh1	T	A	1: 192,418,941		probably benign	Het
Kctd21	T	C	7: 97,347,541	F74L	probably damaging	Het
Krt23	T	A	11: 99,486,782	I133L	probably damaging	Het
Krt74	T	C	15: 101,763,316		noncoding transcript	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lmtk3	T	A	7: 45,794,112	L740M	possibly damaging	Het
Lrrc10	T	A	10: 117,045,790	L123Q	probably damaging	Het
Map1a	A	T	2: 121,305,774	H2357L	probably benign	Het
Mbl1	A	G	14: 41,158,749	N198S	probably damaging	Het
Mcf2l	A	G	8: 12,997,337	D233G	probably damaging	Het
Msto1	A	G	3: 88,911,541	L269P	probably benign	Het
Mtss1	A	T	15: 58,956,538	D175E	probably benign	Het
Myef2	A	T	2: 125,109,034		probably benign	Het
Neb	A	T	2: 52,290,743		probably benign	Het
Olfr1138	A	G	2: 87,737,481	V281A	probably damaging	Het
Olfr1238	A	T	2: 89,406,791	M96K	probably damaging	Het
Olfr305	T	C	7: 86,363,827	N170S	probably benign	Het
Parp2	T	A	14: 50,819,673	Y361N	probably damaging	Het
Parp3	A	G	9: 106,471,796	F466L	possibly damaging	Het
Pcdh15	A	T	10: 74,290,976	N296Y	probably damaging	Het
Pdzrn3	A	T	6: 101,151,053	I884N	probably damaging	Het
Pim1	T	C	17: 29,493,909		probably benign	Het
Pou6f2	A	G	13: 18,139,723		probably benign	Het
Prelid3b	A	G	2: 174,465,950		probably benign	Het
Proc	G	A	18: 32,125,118	T258I	probably benign	Het
Rab3gap2	T	C	1: 185,260,508		probably benign	Het
Rb1cc1	A	C	1: 6,249,171	K938T	probably benign	Het
Rem2	T	C	14: 54,476,297		probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rin2	A	G	2: 145,861,033	K550E	probably benign	Het
Rps6ka4	G	T	19: 6,840,498	T17N	probably benign	Het
Rtn4	T	A	11: 29,733,849		probably benign	Het
Ruvbl2	C	T	7: 45,431,306		probably benign	Het
Scaper	A	G	9: 55,758,062		probably benign	Het
Sdc2	T	C	15: 33,017,089		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slco2b1	T	A	7: 99,661,536	M603L	probably benign	Het
Smpdl3b	A	G	4: 132,745,138	V108A	probably damaging	Het
Srrm1	G	A	4: 135,338,543		probably benign	Het
Ssh1	A	T	5: 113,946,705	D448E	probably benign	Het
Ssmem1	A	T	6: 30,519,548		probably null	Het
Sv2b	T	G	7: 75,136,392	M427L	probably benign	Het
Syne1	A	G	10: 5,367,600	L498P	probably damaging	Het
Syne2	T	C	12: 75,854,149		probably null	Het
Taf6l	G	T	19: 8,778,521	H254Q	probably benign	Het
Traf3ip3	T	A	1: 193,178,231		probably null	Het
Trpm1	G	A	7: 64,223,758	G587D	probably damaging	Het
Ttn	A	G	2: 76,730,412	V29215A	probably damaging	Het
Ubr4	T	G	4: 139,430,223	S2364A	probably benign	Het
Ush2a	T	A	1: 188,734,663		probably benign	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r57	A	T	7: 41,427,792	S317T	possibly damaging	Het
Vwa2	A	G	19: 56,898,068		probably benign	Het
Wdr73	G	A	7: 80,897,950	Q107*	probably null	Het
Zbtb10	T	A	3: 9,264,668	V362E	probably damaging	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zfp296	A	T	7: 19,577,906	M113L	probably benign	Het
Zfp729b	A	T	13: 67,591,134	V1004E	probably benign	Het

Other mutations in Sptbn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sptbn4	APN	7	27369434	missense	probably damaging	1.00
IGL00468:Sptbn4	APN	7	27417965	missense	probably damaging	1.00
IGL01396:Sptbn4	APN	7	27414771	missense	probably benign	0.06
IGL01700:Sptbn4	APN	7	27404268	missense	probably damaging	1.00
IGL01878:Sptbn4	APN	7	27364146	missense	probably damaging	0.99
IGL02066:Sptbn4	APN	7	27364515	missense	possibly damaging	0.68
IGL02116:Sptbn4	APN	7	27364357	missense	probably benign
IGL02226:Sptbn4	APN	7	27365707	missense	probably damaging	1.00
IGL02333:Sptbn4	APN	7	27364299	missense	probably damaging	1.00
IGL02337:Sptbn4	APN	7	27428247	missense	probably benign	0.03
IGL02451:Sptbn4	APN	7	27365589	missense	probably null	0.15
IGL02487:Sptbn4	APN	7	27419097	missense	probably damaging	1.00
IGL02530:Sptbn4	APN	7	27391551	missense	probably damaging	1.00
IGL02724:Sptbn4	APN	7	27367679	missense	probably damaging	1.00
IGL02850:Sptbn4	APN	7	27426833	missense	possibly damaging	0.95
IGL02851:Sptbn4	APN	7	27426833	missense	possibly damaging	0.95
IGL02869:Sptbn4	APN	7	27394148	splice site	probably benign
IGL02961:Sptbn4	APN	7	27397967	missense	probably damaging	1.00
ANU22:Sptbn4	UTSW	7	27357387	nonsense	probably null
R0194:Sptbn4	UTSW	7	27404911	missense	probably benign	0.00
R0328:Sptbn4	UTSW	7	27364170	missense	probably damaging	1.00
R0379:Sptbn4	UTSW	7	27359736	splice site	probably benign
R0550:Sptbn4	UTSW	7	27364378	missense	probably benign	0.16
R0557:Sptbn4	UTSW	7	27408328	nonsense	probably null
R1336:Sptbn4	UTSW	7	27417963	missense	probably damaging	1.00
R1494:Sptbn4	UTSW	7	27434294	missense	probably damaging	1.00
R1630:Sptbn4	UTSW	7	27418739	missense	probably benign	0.09
R1803:Sptbn4	UTSW	7	27418583	missense	probably damaging	1.00
R1834:Sptbn4	UTSW	7	27366646	missense	probably null	0.96
R1906:Sptbn4	UTSW	7	27391431	critical splice donor site	probably null
R1924:Sptbn4	UTSW	7	27407138	missense	probably damaging	1.00
R1951:Sptbn4	UTSW	7	27366443	missense	possibly damaging	0.64
R1989:Sptbn4	UTSW	7	27367702	missense	probably damaging	1.00
R1990:Sptbn4	UTSW	7	27423810	missense	probably benign	0.19
R2005:Sptbn4	UTSW	7	27366419	nonsense	probably null
R2083:Sptbn4	UTSW	7	27428256	missense	probably benign	0.29
R2176:Sptbn4	UTSW	7	27364162	missense	probably benign	0.21
R2211:Sptbn4	UTSW	7	27367609	missense	probably damaging	1.00
R2262:Sptbn4	UTSW	7	27434357	missense	probably damaging	1.00
R2263:Sptbn4	UTSW	7	27434357	missense	probably damaging	1.00
R2374:Sptbn4	UTSW	7	27360092	missense	probably damaging	0.99
R2407:Sptbn4	UTSW	7	27418098	nonsense	probably null
R4115:Sptbn4	UTSW	7	27391570	missense	probably damaging	1.00
R4116:Sptbn4	UTSW	7	27391570	missense	probably damaging	1.00
R4392:Sptbn4	UTSW	7	27418471	missense	probably damaging	0.97
R4426:Sptbn4	UTSW	7	27423798	missense	probably damaging	1.00
R4535:Sptbn4	UTSW	7	27367702	missense	probably damaging	1.00
R4684:Sptbn4	UTSW	7	27364419	missense	probably damaging	0.96
R4684:Sptbn4	UTSW	7	27366735	missense	possibly damaging	0.60
R4707:Sptbn4	UTSW	7	27417006	missense	probably benign	0.12
R4876:Sptbn4	UTSW	7	27372152	missense	probably damaging	1.00
R5091:Sptbn4	UTSW	7	27369391	missense	probably damaging	1.00
R5371:Sptbn4	UTSW	7	27359741	critical splice donor site	probably null
R5790:Sptbn4	UTSW	7	27366428	missense	probably damaging	0.99
R5857:Sptbn4	UTSW	7	27418713	missense	possibly damaging	0.89
R5908:Sptbn4	UTSW	7	27404253	missense	probably benign	0.00
R5980:Sptbn4	UTSW	7	27372171	missense	probably damaging	1.00
R6005:Sptbn4	UTSW	7	27418599	missense	probably damaging	1.00
R6013:Sptbn4	UTSW	7	27364479	missense	probably damaging	0.99
R6037:Sptbn4	UTSW	7	27364170	missense	probably damaging	0.97
R6037:Sptbn4	UTSW	7	27364170	missense	probably damaging	0.97
R6129:Sptbn4	UTSW	7	27360088	missense	probably damaging	0.98
R6146:Sptbn4	UTSW	7	27364587	nonsense	probably null
R6762:Sptbn4	UTSW	7	27394208	missense	probably damaging	1.00
R6897:Sptbn4	UTSW	7	27371950	missense	possibly damaging	0.96
R7178:Sptbn4	UTSW	7	27418056	missense	probably damaging	1.00
R7212:Sptbn4	UTSW	7	27416785	missense	probably benign	0.44
R7465:Sptbn4	UTSW	7	27366689	missense	probably benign	0.00
R7471:Sptbn4	UTSW	7	27409014	missense	possibly damaging	0.64
R7510:Sptbn4	UTSW	7	27428268	missense	probably benign	0.13
R7527:Sptbn4	UTSW	7	27375590	missense	possibly damaging	0.94
R7528:Sptbn4	UTSW	7	27442535	missense	probably benign	0.00
R7572:Sptbn4	UTSW	7	27372272	missense	probably damaging	0.99
R7649:Sptbn4	UTSW	7	27361577	missense	possibly damaging	0.80
R7714:Sptbn4	UTSW	7	27364336	missense	probably benign	0.02
R7780:Sptbn4	UTSW	7	27361634	missense	possibly damaging	0.70
R7854:Sptbn4	UTSW	7	27362410	missense	probably benign
R8002:Sptbn4	UTSW	7	27417992	missense	possibly damaging	0.91
R8058:Sptbn4	UTSW	7	27364269	missense	possibly damaging	0.92
R8181:Sptbn4	UTSW	7	27375383	missense	possibly damaging	0.79
R8195:Sptbn4	UTSW	7	27408889	nonsense	probably null
R8353:Sptbn4	UTSW	7	27404238	missense	probably damaging	1.00
R8392:Sptbn4	UTSW	7	27372296	missense	probably damaging	1.00
R8453:Sptbn4	UTSW	7	27404238	missense	probably damaging	1.00
R8815:Sptbn4	UTSW	7	27407232	nonsense	probably null
R8818:Sptbn4	UTSW	7	27364167	missense	possibly damaging	0.71
R9171:Sptbn4	UTSW	7	27442419	missense	possibly damaging	0.95
R9259:Sptbn4	UTSW	7	27367699	missense	possibly damaging	0.74
R9477:Sptbn4	UTSW	7	27433199	missense	possibly damaging	0.79
R9564:Sptbn4	UTSW	7	27418079	missense	probably damaging	0.98
R9572:Sptbn4	UTSW	7	27366670	missense	probably benign	0.16
R9623:Sptbn4	UTSW	7	27408382	missense	probably damaging	1.00
R9715:Sptbn4	UTSW	7	27391575	missense	probably damaging	1.00
R9782:Sptbn4	UTSW	7	27408568	missense	probably benign	0.02
R9790:Sptbn4	UTSW	7	27372237	missense	probably damaging	0.99
R9791:Sptbn4	UTSW	7	27372237	missense	probably damaging	0.99
R9798:Sptbn4	UTSW	7	27357292	makesense	probably null
X0020:Sptbn4	UTSW	7	27402734	critical splice donor site	probably null
X0066:Sptbn4	UTSW	7	27357311	unclassified	probably benign
Z1176:Sptbn4	UTSW	7	27360025	missense	probably damaging	0.99
Z1177:Sptbn4	UTSW	7	27404582	missense	probably damaging	1.00
Z1177:Sptbn4	UTSW	7	27409102	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- TAGACTCTACCTCCAGGTTGCTGC -3'
(R):5'- AGTCATCATGCACAGTACCCCTCTC -3'

Sequencing Primer
(F):5'- AGGGACACTTTTGTCATGCTC -3'
(R):5'- TCATTCACACAGCCGTCG -3'

Posted On

2014-02-20