Incidental Mutation 'R0445:Gpr155'
ID158486
Institutional Source Beutler Lab
Gene Symbol Gpr155
Ensembl Gene ENSMUSG00000041762
Gene NameG protein-coupled receptor 155
SynonymsPGR22, 1110017O10Rik, DEPDC3, F730029F15Rik
MMRRC Submission 038646-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0445 (G1)
Quality Score39
Status Validated
Chromosome2
Chromosomal Location73341506-73386572 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 73370144 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076463] [ENSMUST00000112043] [ENSMUST00000112044]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048504
SMART Domains Protein: ENSMUSP00000037772
Gene: ENSMUSG00000041762

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 1.9e-16 PFAM
Pfam:Mem_trans 187 360 4.9e-12 PFAM
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076463
SMART Domains Protein: ENSMUSP00000075788
Gene: ENSMUSG00000041762

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 272 291 N/A INTRINSIC
transmembrane domain 311 330 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
transmembrane domain 689 711 N/A INTRINSIC
DEP 759 833 8.28e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112043
SMART Domains Protein: ENSMUSP00000107674
Gene: ENSMUSG00000041762

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
transmembrane domain 209 231 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 272 291 N/A INTRINSIC
transmembrane domain 311 330 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 380 402 N/A INTRINSIC
transmembrane domain 415 432 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 519 538 N/A INTRINSIC
transmembrane domain 657 679 N/A INTRINSIC
transmembrane domain 689 711 N/A INTRINSIC
DEP 759 833 8.28e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112044
SMART Domains Protein: ENSMUSP00000107675
Gene: ENSMUSG00000041762

DomainStartEndE-ValueType
Pfam:Mem_trans 40 205 3.3e-15 PFAM
Pfam:Mem_trans 187 360 8.3e-11 PFAM
transmembrane domain 382 404 N/A INTRINSIC
transmembrane domain 414 436 N/A INTRINSIC
transmembrane domain 449 471 N/A INTRINSIC
transmembrane domain 491 510 N/A INTRINSIC
transmembrane domain 629 651 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
DEP 731 805 8.28e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184503
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A C 17: 48,090,022 probably null Het
4932438A13Rik T C 3: 37,000,065 V3111A probably damaging Het
A2m C T 6: 121,657,955 T687I probably damaging Het
Acsbg1 A G 9: 54,615,895 S483P probably damaging Het
Adam22 T A 5: 8,180,591 probably benign Het
Aggf1 A G 13: 95,354,001 V595A possibly damaging Het
Aplf A T 6: 87,663,752 L71I probably damaging Het
Arid3c G T 4: 41,725,172 P292T probably benign Het
Brms1l T A 12: 55,861,406 Y213* probably null Het
C87436 T A 6: 86,449,850 S332T possibly damaging Het
Cad G A 5: 31,072,709 A1454T probably benign Het
Cdkn3 T C 14: 46,767,400 probably null Het
Cnot1 A G 8: 95,760,208 C624R probably damaging Het
Cntnap5c A T 17: 58,104,743 I541F probably benign Het
Cyhr1 T C 15: 76,648,257 H217R probably damaging Het
Dennd1b A G 1: 139,167,765 probably benign Het
Dscam A T 16: 96,772,503 I753N probably damaging Het
Eef2 C CN 10: 81,178,770 probably null Het
Epg5 T A 18: 78,014,184 V1826D possibly damaging Het
Epha8 T C 4: 136,932,400 Y755C probably damaging Het
Esco1 A T 18: 10,574,989 N694K probably damaging Het
Fermt3 T C 19: 7,003,299 H300R probably benign Het
Galnt5 C A 2: 57,998,950 F187L probably benign Het
Gm17067 A G 7: 42,708,622 I152T probably benign Het
Gnb3 T C 6: 124,837,255 D154G possibly damaging Het
Hdac3 A G 18: 37,943,724 I240T probably damaging Het
Ifitm1 A T 7: 140,968,441 probably null Het
Kif1b A T 4: 149,188,009 L1455Q probably benign Het
Krt1 A C 15: 101,847,621 L388R probably damaging Het
Lrp1 T A 10: 127,590,636 K635* probably null Het
Map3k2 A G 18: 32,217,210 Y371C probably damaging Het
Mcu T C 10: 59,456,645 probably benign Het
Mkrn1 C T 6: 39,404,854 V167I probably benign Het
Mrpl9 T A 3: 94,444,891 probably benign Het
Naip2 T C 13: 100,161,887 Y547C possibly damaging Het
Nup88 G A 11: 70,947,729 T487I probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Obscn C T 11: 58,999,335 R7457H unknown Het
Olfr1383 T A 11: 49,523,957 V78E probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Paf1 T C 7: 28,395,688 S118P probably damaging Het
Parp4 T A 14: 56,602,748 probably null Het
Pcdh15 A T 10: 74,342,549 Y157F probably damaging Het
Pex10 G A 4: 155,069,074 probably null Het
Phrf1 C T 7: 141,247,331 probably benign Het
Polr3a G T 14: 24,454,921 D1090E probably benign Het
Ppfia4 A C 1: 134,327,289 L276R probably benign Het
Rdh16f1 T C 10: 127,790,867 L263S probably benign Het
Ryr3 T C 2: 112,866,054 D967G probably benign Het
Shc1 G T 3: 89,426,537 A226S probably damaging Het
Slc4a1 A G 11: 102,354,366 V585A probably benign Het
Stk38l T A 6: 146,775,686 S461T probably benign Het
Tbkbp1 A T 11: 97,149,469 S40T probably damaging Het
Tet1 A G 10: 62,879,941 M25T probably benign Het
Themis A G 10: 28,782,011 R192G probably damaging Het
Tmem144 T C 3: 79,825,354 T206A probably benign Het
Tmem74b G A 2: 151,706,959 R202H probably damaging Het
Trpm1 T C 7: 64,244,842 probably benign Het
Vars A G 17: 35,011,809 H557R probably benign Het
Zbtb12 C A 17: 34,896,301 A354E possibly damaging Het
Zfp143 A T 7: 110,061,117 probably benign Het
Other mutations in Gpr155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Gpr155 APN 2 73362613 missense probably damaging 1.00
IGL01432:Gpr155 APN 2 73351885 missense possibly damaging 0.51
IGL01528:Gpr155 APN 2 73362423 critical splice donor site probably null
IGL01718:Gpr155 APN 2 73382232 missense probably benign
IGL01733:Gpr155 APN 2 73353612 splice site probably null
IGL03342:Gpr155 APN 2 73349678 missense probably damaging 1.00
PIT1430001:Gpr155 UTSW 2 73370138 missense probably benign 0.08
PIT4810001:Gpr155 UTSW 2 73348263 missense probably benign 0.08
R0226:Gpr155 UTSW 2 73367592 missense probably benign 0.02
R0399:Gpr155 UTSW 2 73370002 missense possibly damaging 0.91
R1570:Gpr155 UTSW 2 73370038 missense possibly damaging 0.87
R1598:Gpr155 UTSW 2 73370090 missense probably damaging 0.98
R1647:Gpr155 UTSW 2 73364164 unclassified probably null
R1648:Gpr155 UTSW 2 73364164 unclassified probably null
R1756:Gpr155 UTSW 2 73367577 missense probably benign 0.00
R1760:Gpr155 UTSW 2 73381935 missense probably damaging 1.00
R2033:Gpr155 UTSW 2 73348182 missense probably benign 0.18
R2044:Gpr155 UTSW 2 73373633 missense probably damaging 1.00
R2145:Gpr155 UTSW 2 73356658 missense probably benign 0.01
R2172:Gpr155 UTSW 2 73382127 missense probably benign 0.00
R2274:Gpr155 UTSW 2 73348135 critical splice donor site probably null
R3878:Gpr155 UTSW 2 73368392 nonsense probably null
R3924:Gpr155 UTSW 2 73370076 missense probably damaging 1.00
R4910:Gpr155 UTSW 2 73367538 nonsense probably null
R4950:Gpr155 UTSW 2 73382185 missense probably benign
R5337:Gpr155 UTSW 2 73348248 missense probably benign 0.32
R5830:Gpr155 UTSW 2 73370089 missense possibly damaging 0.93
R5887:Gpr155 UTSW 2 73343718 nonsense probably null
R5929:Gpr155 UTSW 2 73373667 nonsense probably null
R6293:Gpr155 UTSW 2 73373997 missense possibly damaging 0.47
R6553:Gpr155 UTSW 2 73349645 missense probably damaging 1.00
R6585:Gpr155 UTSW 2 73349645 missense probably damaging 1.00
R7003:Gpr155 UTSW 2 73343617 missense probably damaging 0.99
R7353:Gpr155 UTSW 2 73367491 nonsense probably null
R7506:Gpr155 UTSW 2 73368339 missense probably damaging 0.97
R7631:Gpr155 UTSW 2 73382947 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCTCAAAACTCCTGACTGGAAAGACAT -3'
(R):5'- GGGGCCAACAGAGCATTCTCTTATAAC -3'

Sequencing Primer
(F):5'- GTGGTTTCCATTCAATTTGACAG -3'
(R):5'- TCTCTTATAACAGAGAAGTACGGCAG -3'
Posted On2014-02-20