Incidental Mutation 'R0006:Aebp1'
ID158514
Institutional Source Beutler Lab
Gene Symbol Aebp1
Ensembl Gene ENSMUSG00000020473
Gene NameAE binding protein 1
SynonymsACLP
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0006 (G1)
Quality Score55
Status Validated
Chromosome11
Chromosomal Location5861947-5872088 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 5863935 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102923] [ENSMUST00000109829]
Predicted Effect probably benign
Transcript: ENSMUST00000102923
SMART Domains Protein: ENSMUSP00000099987
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 46 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
low complexity region 113 159 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
low complexity region 264 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
FA58C 375 531 8.72e-46 SMART
Zn_pept 555 983 5.56e-43 SMART
low complexity region 1005 1029 N/A INTRINSIC
low complexity region 1035 1052 N/A INTRINSIC
low complexity region 1069 1089 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109829
SMART Domains Protein: ENSMUSP00000105454
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
FA58C 1 151 2.04e-37 SMART
Zn_pept 175 603 5.56e-43 SMART
low complexity region 625 649 N/A INTRINSIC
low complexity region 655 672 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of carboxypeptidase A protein family. The encoded protein may function as a transcriptional repressor and play a role in adipogenesis and smooth muscle cell differentiation. Studies in mice suggest that this gene functions in wound healing and abdominal wall development. Overexpression of this gene is associated with glioblastoma. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for one null allele exhibit neonatal lethality, abdominal wall herniation, extrusion of the abdominal organs, and defects in wound healing. Mice homozygous for another null allele exhibit embryonic lethality, decreased white adipose tissue, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Aebp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Aebp1 APN 11 5871787 missense possibly damaging 0.67
IGL01464:Aebp1 APN 11 5869822 missense possibly damaging 0.46
IGL01561:Aebp1 APN 11 5871349 missense probably damaging 1.00
IGL01648:Aebp1 APN 11 5870607 missense possibly damaging 0.96
IGL01950:Aebp1 APN 11 5869108 missense probably benign 0.02
IGL02094:Aebp1 APN 11 5868357 missense probably benign 0.17
IGL02585:Aebp1 APN 11 5870855 splice site probably null
R0551:Aebp1 UTSW 11 5867955 missense probably benign 0.04
R1144:Aebp1 UTSW 11 5868475 missense probably benign 0.17
R1265:Aebp1 UTSW 11 5871740 missense probably damaging 0.98
R1297:Aebp1 UTSW 11 5870834 missense possibly damaging 0.69
R1518:Aebp1 UTSW 11 5871469 missense possibly damaging 0.58
R1524:Aebp1 UTSW 11 5870089 missense probably damaging 0.98
R2567:Aebp1 UTSW 11 5870251 missense probably benign 0.29
R3155:Aebp1 UTSW 11 5871425 missense probably benign 0.16
R4415:Aebp1 UTSW 11 5865451 missense probably damaging 0.96
R4507:Aebp1 UTSW 11 5870565 missense probably damaging 1.00
R5248:Aebp1 UTSW 11 5868501 missense possibly damaging 0.63
R5597:Aebp1 UTSW 11 5866487 missense probably benign 0.01
R5809:Aebp1 UTSW 11 5870257 missense probably benign
R5919:Aebp1 UTSW 11 5871421 missense probably benign 0.00
R5982:Aebp1 UTSW 11 5867911 missense possibly damaging 0.69
R6139:Aebp1 UTSW 11 5871842 missense probably damaging 1.00
R7067:Aebp1 UTSW 11 5866431 critical splice acceptor site probably null
R7289:Aebp1 UTSW 11 5865059 missense probably damaging 1.00
R7383:Aebp1 UTSW 11 5868548 missense probably damaging 1.00
R7437:Aebp1 UTSW 11 5869757 missense possibly damaging 0.50
Z1088:Aebp1 UTSW 11 5871460 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCAAGAGTTGCTGCTGTTCAC -3'
(R):5'- AGTTGAGAACTTCTTTCCTGCCGAG -3'

Sequencing Primer
(F):5'- CTCTGGATGTACAGATAGGATGCC -3'
(R):5'- TGCCGAGGGCCTCTTAG -3'
Posted On2014-03-07