Incidental Mutation 'R1457:Map3k19'
ID 158532
Institutional Source Beutler Lab
Gene Symbol Map3k19
Ensembl Gene ENSMUSG00000051590
Gene Name mitogen-activated protein kinase kinase kinase 19
Synonyms Ysk4
MMRRC Submission 039512-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.090) question?
Stock # R1457 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 127742528-127782768 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 127745635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Arginine at position 1273 (I1273R)
Ref Sequence ENSEMBL: ENSMUSP00000146463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000208183]
AlphaFold E9Q3S4
Predicted Effect probably damaging
Transcript: ENSMUST00000061512
AA Change: I1069R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590
AA Change: I1069R

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
S_TKc 1044 1307 3.18e-90 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187653
AA Change: I968R
SMART Domains Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590
AA Change: I968R

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
S_TKc 933 1196 1.5e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189398
SMART Domains Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 216 452 4.8e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000191333
AA Change: I272R
SMART Domains Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590
AA Change: I272R

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 237 500 1.5e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000208183
AA Change: I1273R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,888,683 (GRCm39) I1210F probably benign Het
Ankrd17 T C 5: 90,433,705 (GRCm39) H688R possibly damaging Het
Arhgap24 T A 5: 102,811,972 (GRCm39) N66K probably damaging Het
Atp1a1 C T 3: 101,497,782 (GRCm39) G335D probably damaging Het
Cacna1g C T 11: 94,350,381 (GRCm39) R488H possibly damaging Het
Cacna1h A T 17: 25,616,594 (GRCm39) V149E probably damaging Het
Cd22 G T 7: 30,572,595 (GRCm39) P338Q probably benign Het
Cntln G T 4: 85,015,076 (GRCm39) M1122I probably benign Het
Cntrl A G 2: 35,012,768 (GRCm39) N302S probably benign Het
Cog8 T C 8: 107,779,528 (GRCm39) R250G probably damaging Het
Cracdl A T 1: 37,665,093 (GRCm39) Y268* probably null Het
Creld2 T C 15: 88,707,956 (GRCm39) C232R probably damaging Het
Cyp2b23 G A 7: 26,372,574 (GRCm39) P347L probably damaging Het
Dnah5 T C 15: 28,403,688 (GRCm39) probably null Het
Eml6 C T 11: 29,974,459 (GRCm39) V40I probably damaging Het
Epb42 C T 2: 120,860,448 (GRCm39) probably null Het
Fcrla A G 1: 170,748,573 (GRCm39) L190P probably damaging Het
Galnt18 A T 7: 111,378,635 (GRCm39) Y40* probably null Het
Gdf7 A T 12: 8,348,073 (GRCm39) M416K probably damaging Het
Gm11232 T A 4: 71,675,156 (GRCm39) probably null Het
Gpam T A 19: 55,076,608 (GRCm39) N198Y probably damaging Het
Grip1 C T 10: 119,822,255 (GRCm39) S327F possibly damaging Het
Hey2 C T 10: 30,710,352 (GRCm39) A134T probably benign Het
Kat6a T C 8: 23,428,668 (GRCm39) I1341T probably benign Het
Kcnd3 T C 3: 105,575,502 (GRCm39) L542P probably benign Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lman2 T C 13: 55,499,064 (GRCm39) D234G probably benign Het
Matn1 T A 4: 130,677,330 (GRCm39) F180I possibly damaging Het
Meikin T A 11: 54,261,767 (GRCm39) L61* probably null Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Myh13 T C 11: 67,221,872 (GRCm39) I199T probably damaging Het
Myh4 T A 11: 67,139,287 (GRCm39) S535T probably damaging Het
Myo5a T C 9: 75,120,347 (GRCm39) M1715T probably damaging Het
Nat8 A T 6: 85,807,971 (GRCm39) V54D probably damaging Het
Nbea A G 3: 55,992,748 (GRCm39) V286A probably damaging Het
Ndnf A G 6: 65,680,998 (GRCm39) K426E possibly damaging Het
Nup210l T A 3: 90,098,279 (GRCm39) N1410K possibly damaging Het
Oca2 A T 7: 55,971,269 (GRCm39) T399S probably damaging Het
Or10al2 A T 17: 37,983,816 (GRCm39) K301* probably null Het
Or1af1 A C 2: 37,109,671 (GRCm39) T57P possibly damaging Het
Or51a43 A T 7: 103,717,666 (GRCm39) C191S probably damaging Het
Or52h7 T A 7: 104,214,278 (GRCm39) N283K probably damaging Het
Or8c10 G A 9: 38,279,492 (GRCm39) V217I probably benign Het
Or8j3 A G 2: 86,028,596 (GRCm39) S167P probably damaging Het
Otogl A C 10: 107,714,013 (GRCm39) probably null Het
Pde4b C T 4: 102,462,373 (GRCm39) T511I probably damaging Het
Proser3 A G 7: 30,239,172 (GRCm39) probably null Het
Psmd12 G A 11: 107,370,472 (GRCm39) V24M probably damaging Het
Rbm17 A T 2: 11,598,272 (GRCm39) M170K probably benign Het
Rims2 C T 15: 39,374,710 (GRCm39) T1064I possibly damaging Het
Ripor3 C T 2: 167,834,573 (GRCm39) V281M probably damaging Het
Rreb1 C A 13: 38,130,904 (GRCm39) Q1353K possibly damaging Het
Sgo2a A G 1: 58,054,965 (GRCm39) D383G probably benign Het
Sik3 C T 9: 46,132,446 (GRCm39) T1346M probably damaging Het
Slx1b A T 7: 126,291,968 (GRCm39) V63E probably damaging Het
Son A G 16: 91,453,974 (GRCm39) D907G probably damaging Het
Src G A 2: 157,311,132 (GRCm39) V401M probably damaging Het
St3gal4 T C 9: 34,966,053 (GRCm39) K24E possibly damaging Het
Stat6 A G 10: 127,494,114 (GRCm39) K647R probably damaging Het
Tbl1xr1 G A 3: 22,247,333 (GRCm39) probably null Het
Tlk2 G A 11: 105,147,778 (GRCm39) probably null Het
Tmbim6 T A 15: 99,299,496 (GRCm39) I3K probably benign Het
Tmeff2 A T 1: 51,221,026 (GRCm39) I334F probably damaging Het
Ttn T C 2: 76,670,659 (GRCm39) probably null Het
Ubl7 T A 9: 57,821,894 (GRCm39) I81N probably damaging Het
Ugt1a10 A G 1: 87,983,433 (GRCm39) Y77C probably damaging Het
Uqcrfs1 A G 13: 30,724,890 (GRCm39) C217R probably damaging Het
Usp50 T C 2: 126,603,554 (GRCm39) T331A probably benign Het
Vmn1r65 A G 7: 6,012,156 (GRCm39) V26A probably benign Het
Wdfy3 A C 5: 102,065,445 (GRCm39) V1241G possibly damaging Het
Wtap A C 17: 13,200,631 (GRCm39) probably null Het
Zbtb40 C A 4: 136,712,148 (GRCm39) A1187S possibly damaging Het
Zfp57 T C 17: 37,316,990 (GRCm39) S20P probably damaging Het
Zfp592 A G 7: 80,674,227 (GRCm39) D397G probably damaging Het
Zfp747 A T 7: 126,973,676 (GRCm39) S165T probably benign Het
Zfp949 C T 9: 88,451,891 (GRCm39) T487I probably damaging Het
Zscan4d A G 7: 10,898,921 (GRCm39) C119R probably damaging Het
Other mutations in Map3k19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Map3k19 APN 1 127,752,068 (GRCm39) nonsense probably null
IGL01367:Map3k19 APN 1 127,752,088 (GRCm39) missense possibly damaging 0.88
IGL01443:Map3k19 APN 1 127,766,244 (GRCm39) missense probably benign 0.38
IGL01481:Map3k19 APN 1 127,750,215 (GRCm39) missense probably damaging 0.99
IGL01530:Map3k19 APN 1 127,749,841 (GRCm39) missense probably damaging 1.00
IGL01603:Map3k19 APN 1 127,758,010 (GRCm39) missense possibly damaging 0.89
IGL02044:Map3k19 APN 1 127,751,242 (GRCm39) missense probably damaging 1.00
IGL02159:Map3k19 APN 1 127,750,907 (GRCm39) missense probably benign 0.00
IGL02296:Map3k19 APN 1 127,751,983 (GRCm39) missense probably damaging 1.00
IGL02349:Map3k19 APN 1 127,751,506 (GRCm39) missense possibly damaging 0.48
IGL02823:Map3k19 APN 1 127,750,001 (GRCm39) missense probably benign 0.01
IGL02965:Map3k19 APN 1 127,751,803 (GRCm39) missense probably damaging 0.98
IGL03137:Map3k19 APN 1 127,752,052 (GRCm39) missense probably benign 0.04
R0125:Map3k19 UTSW 1 127,750,837 (GRCm39) missense probably benign 0.07
R0265:Map3k19 UTSW 1 127,749,919 (GRCm39) missense possibly damaging 0.61
R0389:Map3k19 UTSW 1 127,750,152 (GRCm39) missense probably benign 0.08
R0443:Map3k19 UTSW 1 127,750,152 (GRCm39) missense probably benign 0.08
R0465:Map3k19 UTSW 1 127,766,264 (GRCm39) missense probably damaging 1.00
R0645:Map3k19 UTSW 1 127,749,919 (GRCm39) missense possibly damaging 0.61
R0759:Map3k19 UTSW 1 127,745,162 (GRCm39) missense possibly damaging 0.90
R0815:Map3k19 UTSW 1 127,762,375 (GRCm39) splice site probably benign
R0838:Map3k19 UTSW 1 127,751,696 (GRCm39) missense probably benign 0.13
R1173:Map3k19 UTSW 1 127,751,617 (GRCm39) missense probably benign 0.17
R1174:Map3k19 UTSW 1 127,751,617 (GRCm39) missense probably benign 0.17
R1175:Map3k19 UTSW 1 127,751,617 (GRCm39) missense probably benign 0.17
R1661:Map3k19 UTSW 1 127,745,393 (GRCm39) missense possibly damaging 0.95
R1665:Map3k19 UTSW 1 127,745,393 (GRCm39) missense possibly damaging 0.95
R1753:Map3k19 UTSW 1 127,750,417 (GRCm39) missense probably benign 0.02
R1944:Map3k19 UTSW 1 127,750,859 (GRCm39) missense probably benign 0.29
R2496:Map3k19 UTSW 1 127,750,823 (GRCm39) missense probably damaging 1.00
R2878:Map3k19 UTSW 1 127,751,530 (GRCm39) missense possibly damaging 0.61
R2895:Map3k19 UTSW 1 127,749,835 (GRCm39) missense possibly damaging 0.60
R3025:Map3k19 UTSW 1 127,766,290 (GRCm39) critical splice acceptor site probably null
R4577:Map3k19 UTSW 1 127,750,550 (GRCm39) nonsense probably null
R4612:Map3k19 UTSW 1 127,743,037 (GRCm39) missense probably benign 0.07
R4888:Map3k19 UTSW 1 127,745,470 (GRCm39) missense probably damaging 1.00
R4927:Map3k19 UTSW 1 127,749,932 (GRCm39) missense probably benign 0.08
R5028:Map3k19 UTSW 1 127,750,969 (GRCm39) missense probably benign 0.00
R5050:Map3k19 UTSW 1 127,751,299 (GRCm39) missense probably benign 0.21
R5131:Map3k19 UTSW 1 127,751,427 (GRCm39) missense possibly damaging 0.78
R5556:Map3k19 UTSW 1 127,762,284 (GRCm39) nonsense probably null
R5606:Map3k19 UTSW 1 127,750,694 (GRCm39) missense probably benign
R5617:Map3k19 UTSW 1 127,750,703 (GRCm39) missense probably damaging 1.00
R5755:Map3k19 UTSW 1 127,750,118 (GRCm39) missense probably benign 0.02
R5854:Map3k19 UTSW 1 127,758,092 (GRCm39) missense probably damaging 0.96
R5952:Map3k19 UTSW 1 127,750,477 (GRCm39) missense probably benign 0.01
R6132:Map3k19 UTSW 1 127,778,213 (GRCm39) missense possibly damaging 0.53
R6175:Map3k19 UTSW 1 127,750,569 (GRCm39) missense probably benign 0.05
R6261:Map3k19 UTSW 1 127,750,336 (GRCm39) missense possibly damaging 0.95
R6471:Map3k19 UTSW 1 127,744,991 (GRCm39) missense probably damaging 1.00
R6726:Map3k19 UTSW 1 127,748,185 (GRCm39) missense probably benign 0.09
R6732:Map3k19 UTSW 1 127,751,969 (GRCm39) missense probably benign 0.37
R6762:Map3k19 UTSW 1 127,775,001 (GRCm39) missense probably damaging 1.00
R7366:Map3k19 UTSW 1 127,745,192 (GRCm39) missense probably damaging 1.00
R7414:Map3k19 UTSW 1 127,766,189 (GRCm39) missense probably damaging 0.99
R7686:Map3k19 UTSW 1 127,749,985 (GRCm39) nonsense probably null
R7702:Map3k19 UTSW 1 127,756,827 (GRCm39) missense probably damaging 1.00
R7849:Map3k19 UTSW 1 127,751,383 (GRCm39) missense probably benign 0.21
R8129:Map3k19 UTSW 1 127,750,420 (GRCm39) missense possibly damaging 0.90
R8134:Map3k19 UTSW 1 127,751,492 (GRCm39) missense probably damaging 0.99
R8136:Map3k19 UTSW 1 127,751,492 (GRCm39) missense probably damaging 0.99
R8264:Map3k19 UTSW 1 127,751,528 (GRCm39) missense
R8305:Map3k19 UTSW 1 127,745,007 (GRCm39) missense
R8511:Map3k19 UTSW 1 127,775,155 (GRCm39) missense possibly damaging 0.71
R8808:Map3k19 UTSW 1 127,751,866 (GRCm39) missense probably damaging 1.00
R8913:Map3k19 UTSW 1 127,750,363 (GRCm39) missense probably benign 0.08
R9025:Map3k19 UTSW 1 127,758,175 (GRCm39) missense probably benign 0.06
R9593:Map3k19 UTSW 1 127,778,163 (GRCm39) missense probably benign 0.01
R9681:Map3k19 UTSW 1 127,750,097 (GRCm39) missense possibly damaging 0.61
Z1177:Map3k19 UTSW 1 127,749,771 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTTAAGCCTGCCCAGGCCAAAC -3'
(R):5'- TACCATCTTGGCTCCCTGGAATGC -3'

Sequencing Primer
(F):5'- GTGGCCCAAAGCGGTTTATTATAC -3'
(R):5'- TCCCTGGAATGCAGGACTTAG -3'
Posted On 2014-03-14