Incidental Mutation 'R1457:Fcrla'
ID158535
Institutional Source Beutler Lab
Gene Symbol Fcrla
Ensembl Gene ENSMUSG00000038421
Gene NameFc receptor-like A
SynonymsFREB, Fcrx, Freb1, mFcrX, mFREB, FCRL1
MMRRC Submission 039512-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1457 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location170917576-170927583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 170921004 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 190 (L190P)
Ref Sequence ENSEMBL: ENSMUSP00000124859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046322] [ENSMUST00000159149] [ENSMUST00000159171] [ENSMUST00000162136] [ENSMUST00000162887]
Predicted Effect probably damaging
Transcript: ENSMUST00000046322
AA Change: L216P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036380
Gene: ENSMUSG00000038421
AA Change: L216P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
IG 95 177 5.75e-4 SMART
IG 188 272 1.4e-7 SMART
low complexity region 281 296 N/A INTRINSIC
low complexity region 310 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159149
SMART Domains Protein: ENSMUSP00000125074
Gene: ENSMUSG00000038421

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
IG 66 148 5.75e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159171
AA Change: L215P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124853
Gene: ENSMUSG00000038421
AA Change: L215P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
IG 94 176 5.75e-4 SMART
IG 187 271 1.4e-7 SMART
low complexity region 280 295 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161050
Predicted Effect probably damaging
Transcript: ENSMUST00000162136
AA Change: L190P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124859
Gene: ENSMUSG00000038421
AA Change: L190P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:Ig_2 83 150 2.2e-6 PFAM
Pfam:Ig_2 156 215 1e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162887
SMART Domains Protein: ENSMUSP00000124469
Gene: ENSMUSG00000038421

DomainStartEndE-ValueType
Pfam:Ig_2 28 78 1.4e-7 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to receptors for the Fc fragment of gamma immunoglobulin (IgG). These receptors, referred to as FCGRs, mediate the destruction of IgG-coated antigens and of cells induced by antibodies. This encoded protein is selectively expressed in B cells, and may be involved in their development. This protein may also be involved in the development of lymphomas. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit largely normal T-dependent and T-independent antibody responses with an increase in IgG1 after secondary challenge with sheep red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,626,012 Y268* probably null Het
Abca14 A T 7: 120,289,460 I1210F probably benign Het
Ankrd17 T C 5: 90,285,846 H688R possibly damaging Het
Arhgap24 T A 5: 102,664,106 N66K probably damaging Het
Atp1a1 C T 3: 101,590,466 G335D probably damaging Het
Cacna1g C T 11: 94,459,555 R488H possibly damaging Het
Cacna1h A T 17: 25,397,620 V149E probably damaging Het
Cd22 G T 7: 30,873,170 P338Q probably benign Het
Cntln G T 4: 85,096,839 M1122I probably benign Het
Cntrl A G 2: 35,122,756 N302S probably benign Het
Cog8 T C 8: 107,052,896 R250G probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Cyp2b23 G A 7: 26,673,149 P347L probably damaging Het
Dnah5 T C 15: 28,403,542 probably null Het
Eml6 C T 11: 30,024,459 V40I probably damaging Het
Epb42 C T 2: 121,029,967 probably null Het
Galnt18 A T 7: 111,779,428 Y40* probably null Het
Gdf7 A T 12: 8,298,073 M416K probably damaging Het
Gm11232 T A 4: 71,756,919 probably null Het
Gpam T A 19: 55,088,176 N198Y probably damaging Het
Grip1 C T 10: 119,986,350 S327F possibly damaging Het
Hey2 C T 10: 30,834,356 A134T probably benign Het
Kat6a T C 8: 22,938,652 I1341T probably benign Het
Kcnd3 T C 3: 105,668,186 L542P probably benign Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lman2 T C 13: 55,351,251 D234G probably benign Het
Map3k19 A C 1: 127,817,898 I1273R probably damaging Het
Matn1 T A 4: 130,950,019 F180I possibly damaging Het
Meikin T A 11: 54,370,941 L61* probably null Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Myh13 T C 11: 67,331,046 I199T probably damaging Het
Myh4 T A 11: 67,248,461 S535T probably damaging Het
Myo5a T C 9: 75,213,065 M1715T probably damaging Het
Nat8 A T 6: 85,830,989 V54D probably damaging Het
Nbea A G 3: 56,085,327 V286A probably damaging Het
Ndnf A G 6: 65,704,014 K426E possibly damaging Het
Nup210l T A 3: 90,190,972 N1410K possibly damaging Het
Oca2 A T 7: 56,321,521 T399S probably damaging Het
Olfr1045 A G 2: 86,198,252 S167P probably damaging Het
Olfr118 A T 17: 37,672,925 K301* probably null Het
Olfr250 G A 9: 38,368,196 V217I probably benign Het
Olfr366 A C 2: 37,219,659 T57P possibly damaging Het
Olfr644 A T 7: 104,068,459 C191S probably damaging Het
Olfr652 T A 7: 104,565,071 N283K probably damaging Het
Otogl A C 10: 107,878,152 probably null Het
Pde4b C T 4: 102,605,176 T511I probably damaging Het
Proser3 A G 7: 30,539,747 probably null Het
Psmd12 G A 11: 107,479,646 V24M probably damaging Het
Rbm17 A T 2: 11,593,461 M170K probably benign Het
Rims2 C T 15: 39,511,314 T1064I possibly damaging Het
Ripor3 C T 2: 167,992,653 V281M probably damaging Het
Rreb1 C A 13: 37,946,928 Q1353K possibly damaging Het
Sgo2a A G 1: 58,015,806 D383G probably benign Het
Sik3 C T 9: 46,221,148 T1346M probably damaging Het
Slx1b A T 7: 126,692,796 V63E probably damaging Het
Son A G 16: 91,657,086 D907G probably damaging Het
Src G A 2: 157,469,212 V401M probably damaging Het
St3gal4 T C 9: 35,054,757 K24E possibly damaging Het
Stat6 A G 10: 127,658,245 K647R probably damaging Het
Tbl1xr1 G A 3: 22,193,169 probably null Het
Tlk2 G A 11: 105,256,952 probably null Het
Tmbim6 T A 15: 99,401,615 I3K probably benign Het
Tmeff2 A T 1: 51,181,867 I334F probably damaging Het
Ttn T C 2: 76,840,315 probably null Het
Ubl7 T A 9: 57,914,611 I81N probably damaging Het
Ugt1a10 A G 1: 88,055,711 Y77C probably damaging Het
Uqcrfs1 A G 13: 30,540,907 C217R probably damaging Het
Usp50 T C 2: 126,761,634 T331A probably benign Het
Vmn1r65 A G 7: 6,009,157 V26A probably benign Het
Wdfy3 A C 5: 101,917,579 V1241G possibly damaging Het
Wtap A C 17: 12,981,744 probably null Het
Zbtb40 C A 4: 136,984,837 A1187S possibly damaging Het
Zfp57 T C 17: 37,006,098 S20P probably damaging Het
Zfp592 A G 7: 81,024,479 D397G probably damaging Het
Zfp747 A T 7: 127,374,504 S165T probably benign Het
Zfp949 C T 9: 88,569,838 T487I probably damaging Het
Zscan4d A G 7: 11,164,994 C119R probably damaging Het
Other mutations in Fcrla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Fcrla APN 1 170927498 missense probably benign 0.00
IGL01712:Fcrla APN 1 170921623 splice site probably null
IGL03323:Fcrla APN 1 170927545 utr 5 prime probably benign
R0113:Fcrla UTSW 1 170922299 start codon destroyed probably null 0.66
R1917:Fcrla UTSW 1 170927526 nonsense probably null
R4331:Fcrla UTSW 1 170921676 missense possibly damaging 0.74
R4819:Fcrla UTSW 1 170920939 missense probably damaging 0.99
R4923:Fcrla UTSW 1 170921113 missense probably damaging 1.00
R5000:Fcrla UTSW 1 170922390 missense probably benign 0.03
R5441:Fcrla UTSW 1 170925422 intron probably benign
R5459:Fcrla UTSW 1 170918169 missense possibly damaging 0.68
R6575:Fcrla UTSW 1 170922228 missense probably damaging 1.00
R7369:Fcrla UTSW 1 170922317 missense probably benign 0.23
R7786:Fcrla UTSW 1 170920857 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGGCTCTGCTTCGAAATCTGTCTG -3'
(R):5'- CACTGTCCAAGGTGAGCATCTGAG -3'

Sequencing Primer
(F):5'- GAAATCTGTCTGTCCTCAGTCAC -3'
(R):5'- ggaagaggagggaggagg -3'
Posted On2014-03-14