Incidental Mutation 'R1457:Rbm17'
ID 158536
Institutional Source Beutler Lab
Gene Symbol Rbm17
Ensembl Gene ENSMUSG00000037197
Gene Name RNA binding motif protein 17
Synonyms 2700027J02Rik
MMRRC Submission 039512-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R1457 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 11590250-11608061 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 11598272 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 170 (M170K)
Ref Sequence ENSEMBL: ENSMUSP00000041831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040314] [ENSMUST00000156469]
AlphaFold Q8JZX4
Predicted Effect probably benign
Transcript: ENSMUST00000040314
AA Change: M170K

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041831
Gene: ENSMUSG00000037197
AA Change: M170K

DomainStartEndE-ValueType
coiled coil region 106 144 N/A INTRINSIC
low complexity region 148 166 N/A INTRINSIC
G_patch 233 279 4.97e-13 SMART
RRM 310 389 4.69e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131036
Predicted Effect probably benign
Transcript: ENSMUST00000156469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195047
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA binding protein. The encoded protein is part of the spliceosome complex and functions in the second catalytic step of mRNA splicing. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 9 and 15. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,888,683 (GRCm39) I1210F probably benign Het
Ankrd17 T C 5: 90,433,705 (GRCm39) H688R possibly damaging Het
Arhgap24 T A 5: 102,811,972 (GRCm39) N66K probably damaging Het
Atp1a1 C T 3: 101,497,782 (GRCm39) G335D probably damaging Het
Cacna1g C T 11: 94,350,381 (GRCm39) R488H possibly damaging Het
Cacna1h A T 17: 25,616,594 (GRCm39) V149E probably damaging Het
Cd22 G T 7: 30,572,595 (GRCm39) P338Q probably benign Het
Cntln G T 4: 85,015,076 (GRCm39) M1122I probably benign Het
Cntrl A G 2: 35,012,768 (GRCm39) N302S probably benign Het
Cog8 T C 8: 107,779,528 (GRCm39) R250G probably damaging Het
Cracdl A T 1: 37,665,093 (GRCm39) Y268* probably null Het
Creld2 T C 15: 88,707,956 (GRCm39) C232R probably damaging Het
Cyp2b23 G A 7: 26,372,574 (GRCm39) P347L probably damaging Het
Dnah5 T C 15: 28,403,688 (GRCm39) probably null Het
Eml6 C T 11: 29,974,459 (GRCm39) V40I probably damaging Het
Epb42 C T 2: 120,860,448 (GRCm39) probably null Het
Fcrla A G 1: 170,748,573 (GRCm39) L190P probably damaging Het
Galnt18 A T 7: 111,378,635 (GRCm39) Y40* probably null Het
Gdf7 A T 12: 8,348,073 (GRCm39) M416K probably damaging Het
Gm11232 T A 4: 71,675,156 (GRCm39) probably null Het
Gpam T A 19: 55,076,608 (GRCm39) N198Y probably damaging Het
Grip1 C T 10: 119,822,255 (GRCm39) S327F possibly damaging Het
Hey2 C T 10: 30,710,352 (GRCm39) A134T probably benign Het
Kat6a T C 8: 23,428,668 (GRCm39) I1341T probably benign Het
Kcnd3 T C 3: 105,575,502 (GRCm39) L542P probably benign Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lman2 T C 13: 55,499,064 (GRCm39) D234G probably benign Het
Map3k19 A C 1: 127,745,635 (GRCm39) I1273R probably damaging Het
Matn1 T A 4: 130,677,330 (GRCm39) F180I possibly damaging Het
Meikin T A 11: 54,261,767 (GRCm39) L61* probably null Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Myh13 T C 11: 67,221,872 (GRCm39) I199T probably damaging Het
Myh4 T A 11: 67,139,287 (GRCm39) S535T probably damaging Het
Myo5a T C 9: 75,120,347 (GRCm39) M1715T probably damaging Het
Nat8 A T 6: 85,807,971 (GRCm39) V54D probably damaging Het
Nbea A G 3: 55,992,748 (GRCm39) V286A probably damaging Het
Ndnf A G 6: 65,680,998 (GRCm39) K426E possibly damaging Het
Nup210l T A 3: 90,098,279 (GRCm39) N1410K possibly damaging Het
Oca2 A T 7: 55,971,269 (GRCm39) T399S probably damaging Het
Or10al2 A T 17: 37,983,816 (GRCm39) K301* probably null Het
Or1af1 A C 2: 37,109,671 (GRCm39) T57P possibly damaging Het
Or51a43 A T 7: 103,717,666 (GRCm39) C191S probably damaging Het
Or52h7 T A 7: 104,214,278 (GRCm39) N283K probably damaging Het
Or8c10 G A 9: 38,279,492 (GRCm39) V217I probably benign Het
Or8j3 A G 2: 86,028,596 (GRCm39) S167P probably damaging Het
Otogl A C 10: 107,714,013 (GRCm39) probably null Het
Pde4b C T 4: 102,462,373 (GRCm39) T511I probably damaging Het
Proser3 A G 7: 30,239,172 (GRCm39) probably null Het
Psmd12 G A 11: 107,370,472 (GRCm39) V24M probably damaging Het
Rims2 C T 15: 39,374,710 (GRCm39) T1064I possibly damaging Het
Ripor3 C T 2: 167,834,573 (GRCm39) V281M probably damaging Het
Rreb1 C A 13: 38,130,904 (GRCm39) Q1353K possibly damaging Het
Sgo2a A G 1: 58,054,965 (GRCm39) D383G probably benign Het
Sik3 C T 9: 46,132,446 (GRCm39) T1346M probably damaging Het
Slx1b A T 7: 126,291,968 (GRCm39) V63E probably damaging Het
Son A G 16: 91,453,974 (GRCm39) D907G probably damaging Het
Src G A 2: 157,311,132 (GRCm39) V401M probably damaging Het
St3gal4 T C 9: 34,966,053 (GRCm39) K24E possibly damaging Het
Stat6 A G 10: 127,494,114 (GRCm39) K647R probably damaging Het
Tbl1xr1 G A 3: 22,247,333 (GRCm39) probably null Het
Tlk2 G A 11: 105,147,778 (GRCm39) probably null Het
Tmbim6 T A 15: 99,299,496 (GRCm39) I3K probably benign Het
Tmeff2 A T 1: 51,221,026 (GRCm39) I334F probably damaging Het
Ttn T C 2: 76,670,659 (GRCm39) probably null Het
Ubl7 T A 9: 57,821,894 (GRCm39) I81N probably damaging Het
Ugt1a10 A G 1: 87,983,433 (GRCm39) Y77C probably damaging Het
Uqcrfs1 A G 13: 30,724,890 (GRCm39) C217R probably damaging Het
Usp50 T C 2: 126,603,554 (GRCm39) T331A probably benign Het
Vmn1r65 A G 7: 6,012,156 (GRCm39) V26A probably benign Het
Wdfy3 A C 5: 102,065,445 (GRCm39) V1241G possibly damaging Het
Wtap A C 17: 13,200,631 (GRCm39) probably null Het
Zbtb40 C A 4: 136,712,148 (GRCm39) A1187S possibly damaging Het
Zfp57 T C 17: 37,316,990 (GRCm39) S20P probably damaging Het
Zfp592 A G 7: 80,674,227 (GRCm39) D397G probably damaging Het
Zfp747 A T 7: 126,973,676 (GRCm39) S165T probably benign Het
Zfp949 C T 9: 88,451,891 (GRCm39) T487I probably damaging Het
Zscan4d A G 7: 10,898,921 (GRCm39) C119R probably damaging Het
Other mutations in Rbm17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Rbm17 APN 2 11,600,249 (GRCm39) unclassified probably benign
R0178:Rbm17 UTSW 2 11,592,590 (GRCm39) missense probably benign 0.04
R0180:Rbm17 UTSW 2 11,592,590 (GRCm39) missense probably benign 0.04
R1606:Rbm17 UTSW 2 11,600,208 (GRCm39) missense probably benign
R1672:Rbm17 UTSW 2 11,590,530 (GRCm39) missense possibly damaging 0.95
R1941:Rbm17 UTSW 2 11,593,885 (GRCm39) missense possibly damaging 0.95
R2327:Rbm17 UTSW 2 11,602,942 (GRCm39) missense probably damaging 1.00
R2859:Rbm17 UTSW 2 11,595,515 (GRCm39) missense possibly damaging 0.84
R3813:Rbm17 UTSW 2 11,600,246 (GRCm39) unclassified probably benign
R5887:Rbm17 UTSW 2 11,590,485 (GRCm39) missense probably damaging 1.00
R6866:Rbm17 UTSW 2 11,602,901 (GRCm39) missense probably benign 0.06
R6985:Rbm17 UTSW 2 11,595,504 (GRCm39) missense probably benign
R8428:Rbm17 UTSW 2 11,605,441 (GRCm39) missense possibly damaging 0.80
Z1176:Rbm17 UTSW 2 11,601,579 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTAAACTCAGGACACAAGAGAGTCA -3'
(R):5'- GGACTCATACTCCCCAGAGGCG -3'

Sequencing Primer
(F):5'- GGACACAAGAGAGTCAAGCTTAG -3'
(R):5'- GCTTGCTGGGGCATTGG -3'
Posted On 2014-03-14