Incidental Mutation 'R1457:Rbm17'
ID158536
Institutional Source Beutler Lab
Gene Symbol Rbm17
Ensembl Gene ENSMUSG00000037197
Gene NameRNA binding motif protein 17
Synonyms2700027J02Rik
MMRRC Submission 039512-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1457 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location11585437-11604153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11593461 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 170 (M170K)
Ref Sequence ENSEMBL: ENSMUSP00000041831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040314] [ENSMUST00000156469]
Predicted Effect probably benign
Transcript: ENSMUST00000040314
AA Change: M170K

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041831
Gene: ENSMUSG00000037197
AA Change: M170K

DomainStartEndE-ValueType
coiled coil region 106 144 N/A INTRINSIC
low complexity region 148 166 N/A INTRINSIC
G_patch 233 279 4.97e-13 SMART
RRM 310 389 4.69e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131036
Predicted Effect probably benign
Transcript: ENSMUST00000156469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195047
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA binding protein. The encoded protein is part of the spliceosome complex and functions in the second catalytic step of mRNA splicing. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 9 and 15. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,626,012 Y268* probably null Het
Abca14 A T 7: 120,289,460 I1210F probably benign Het
Ankrd17 T C 5: 90,285,846 H688R possibly damaging Het
Arhgap24 T A 5: 102,664,106 N66K probably damaging Het
Atp1a1 C T 3: 101,590,466 G335D probably damaging Het
Cacna1g C T 11: 94,459,555 R488H possibly damaging Het
Cacna1h A T 17: 25,397,620 V149E probably damaging Het
Cd22 G T 7: 30,873,170 P338Q probably benign Het
Cntln G T 4: 85,096,839 M1122I probably benign Het
Cntrl A G 2: 35,122,756 N302S probably benign Het
Cog8 T C 8: 107,052,896 R250G probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Cyp2b23 G A 7: 26,673,149 P347L probably damaging Het
Dnah5 T C 15: 28,403,542 probably null Het
Eml6 C T 11: 30,024,459 V40I probably damaging Het
Epb42 C T 2: 121,029,967 probably null Het
Fcrla A G 1: 170,921,004 L190P probably damaging Het
Galnt18 A T 7: 111,779,428 Y40* probably null Het
Gdf7 A T 12: 8,298,073 M416K probably damaging Het
Gm11232 T A 4: 71,756,919 probably null Het
Gpam T A 19: 55,088,176 N198Y probably damaging Het
Grip1 C T 10: 119,986,350 S327F possibly damaging Het
Hey2 C T 10: 30,834,356 A134T probably benign Het
Kat6a T C 8: 22,938,652 I1341T probably benign Het
Kcnd3 T C 3: 105,668,186 L542P probably benign Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lman2 T C 13: 55,351,251 D234G probably benign Het
Map3k19 A C 1: 127,817,898 I1273R probably damaging Het
Matn1 T A 4: 130,950,019 F180I possibly damaging Het
Meikin T A 11: 54,370,941 L61* probably null Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Myh13 T C 11: 67,331,046 I199T probably damaging Het
Myh4 T A 11: 67,248,461 S535T probably damaging Het
Myo5a T C 9: 75,213,065 M1715T probably damaging Het
Nat8 A T 6: 85,830,989 V54D probably damaging Het
Nbea A G 3: 56,085,327 V286A probably damaging Het
Ndnf A G 6: 65,704,014 K426E possibly damaging Het
Nup210l T A 3: 90,190,972 N1410K possibly damaging Het
Oca2 A T 7: 56,321,521 T399S probably damaging Het
Olfr1045 A G 2: 86,198,252 S167P probably damaging Het
Olfr118 A T 17: 37,672,925 K301* probably null Het
Olfr250 G A 9: 38,368,196 V217I probably benign Het
Olfr366 A C 2: 37,219,659 T57P possibly damaging Het
Olfr644 A T 7: 104,068,459 C191S probably damaging Het
Olfr652 T A 7: 104,565,071 N283K probably damaging Het
Otogl A C 10: 107,878,152 probably null Het
Pde4b C T 4: 102,605,176 T511I probably damaging Het
Proser3 A G 7: 30,539,747 probably null Het
Psmd12 G A 11: 107,479,646 V24M probably damaging Het
Rims2 C T 15: 39,511,314 T1064I possibly damaging Het
Ripor3 C T 2: 167,992,653 V281M probably damaging Het
Rreb1 C A 13: 37,946,928 Q1353K possibly damaging Het
Sgo2a A G 1: 58,015,806 D383G probably benign Het
Sik3 C T 9: 46,221,148 T1346M probably damaging Het
Slx1b A T 7: 126,692,796 V63E probably damaging Het
Son A G 16: 91,657,086 D907G probably damaging Het
Src G A 2: 157,469,212 V401M probably damaging Het
St3gal4 T C 9: 35,054,757 K24E possibly damaging Het
Stat6 A G 10: 127,658,245 K647R probably damaging Het
Tbl1xr1 G A 3: 22,193,169 probably null Het
Tlk2 G A 11: 105,256,952 probably null Het
Tmbim6 T A 15: 99,401,615 I3K probably benign Het
Tmeff2 A T 1: 51,181,867 I334F probably damaging Het
Ttn T C 2: 76,840,315 probably null Het
Ubl7 T A 9: 57,914,611 I81N probably damaging Het
Ugt1a10 A G 1: 88,055,711 Y77C probably damaging Het
Uqcrfs1 A G 13: 30,540,907 C217R probably damaging Het
Usp50 T C 2: 126,761,634 T331A probably benign Het
Vmn1r65 A G 7: 6,009,157 V26A probably benign Het
Wdfy3 A C 5: 101,917,579 V1241G possibly damaging Het
Wtap A C 17: 12,981,744 probably null Het
Zbtb40 C A 4: 136,984,837 A1187S possibly damaging Het
Zfp57 T C 17: 37,006,098 S20P probably damaging Het
Zfp592 A G 7: 81,024,479 D397G probably damaging Het
Zfp747 A T 7: 127,374,504 S165T probably benign Het
Zfp949 C T 9: 88,569,838 T487I probably damaging Het
Zscan4d A G 7: 11,164,994 C119R probably damaging Het
Other mutations in Rbm17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Rbm17 APN 2 11595438 unclassified probably benign
R0178:Rbm17 UTSW 2 11587779 missense probably benign 0.04
R0180:Rbm17 UTSW 2 11587779 missense probably benign 0.04
R1606:Rbm17 UTSW 2 11595397 missense probably benign
R1672:Rbm17 UTSW 2 11585719 missense possibly damaging 0.95
R1941:Rbm17 UTSW 2 11589074 missense possibly damaging 0.95
R2327:Rbm17 UTSW 2 11598131 missense probably damaging 1.00
R2859:Rbm17 UTSW 2 11590704 missense possibly damaging 0.84
R3813:Rbm17 UTSW 2 11595435 unclassified probably benign
R5887:Rbm17 UTSW 2 11585674 missense probably damaging 1.00
R6866:Rbm17 UTSW 2 11598090 missense probably benign 0.06
R6985:Rbm17 UTSW 2 11590693 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCTAAACTCAGGACACAAGAGAGTCA -3'
(R):5'- GGACTCATACTCCCCAGAGGCG -3'

Sequencing Primer
(F):5'- GGACACAAGAGAGTCAAGCTTAG -3'
(R):5'- GCTTGCTGGGGCATTGG -3'
Posted On2014-03-14