Incidental Mutation 'R1457:Olfr366'
ID158538
Institutional Source Beutler Lab
Gene Symbol Olfr366
Ensembl Gene ENSMUSG00000068947
Gene Nameolfactory receptor 366
SynonymsGA_x6K02T2NLDC-33902472-33903401, MOR138-6, MOR138-5P
MMRRC Submission 039512-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1457 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37211574-37224506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 37219659 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 57 (T57P)
Ref Sequence ENSEMBL: ENSMUSP00000150608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091001] [ENSMUST00000214897]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091001
AA Change: T57P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088524
Gene: ENSMUSG00000068947
AA Change: T57P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5e-62 PFAM
Pfam:7tm_1 41 290 3.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214897
AA Change: T57P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,626,012 Y268* probably null Het
Abca14 A T 7: 120,289,460 I1210F probably benign Het
Ankrd17 T C 5: 90,285,846 H688R possibly damaging Het
Arhgap24 T A 5: 102,664,106 N66K probably damaging Het
Atp1a1 C T 3: 101,590,466 G335D probably damaging Het
Cacna1g C T 11: 94,459,555 R488H possibly damaging Het
Cacna1h A T 17: 25,397,620 V149E probably damaging Het
Cd22 G T 7: 30,873,170 P338Q probably benign Het
Cntln G T 4: 85,096,839 M1122I probably benign Het
Cntrl A G 2: 35,122,756 N302S probably benign Het
Cog8 T C 8: 107,052,896 R250G probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Cyp2b23 G A 7: 26,673,149 P347L probably damaging Het
Dnah5 T C 15: 28,403,542 probably null Het
Eml6 C T 11: 30,024,459 V40I probably damaging Het
Epb42 C T 2: 121,029,967 probably null Het
Fcrla A G 1: 170,921,004 L190P probably damaging Het
Galnt18 A T 7: 111,779,428 Y40* probably null Het
Gdf7 A T 12: 8,298,073 M416K probably damaging Het
Gm11232 T A 4: 71,756,919 probably null Het
Gpam T A 19: 55,088,176 N198Y probably damaging Het
Grip1 C T 10: 119,986,350 S327F possibly damaging Het
Hey2 C T 10: 30,834,356 A134T probably benign Het
Kat6a T C 8: 22,938,652 I1341T probably benign Het
Kcnd3 T C 3: 105,668,186 L542P probably benign Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lman2 T C 13: 55,351,251 D234G probably benign Het
Map3k19 A C 1: 127,817,898 I1273R probably damaging Het
Matn1 T A 4: 130,950,019 F180I possibly damaging Het
Meikin T A 11: 54,370,941 L61* probably null Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Myh13 T C 11: 67,331,046 I199T probably damaging Het
Myh4 T A 11: 67,248,461 S535T probably damaging Het
Myo5a T C 9: 75,213,065 M1715T probably damaging Het
Nat8 A T 6: 85,830,989 V54D probably damaging Het
Nbea A G 3: 56,085,327 V286A probably damaging Het
Ndnf A G 6: 65,704,014 K426E possibly damaging Het
Nup210l T A 3: 90,190,972 N1410K possibly damaging Het
Oca2 A T 7: 56,321,521 T399S probably damaging Het
Olfr1045 A G 2: 86,198,252 S167P probably damaging Het
Olfr118 A T 17: 37,672,925 K301* probably null Het
Olfr250 G A 9: 38,368,196 V217I probably benign Het
Olfr644 A T 7: 104,068,459 C191S probably damaging Het
Olfr652 T A 7: 104,565,071 N283K probably damaging Het
Otogl A C 10: 107,878,152 probably null Het
Pde4b C T 4: 102,605,176 T511I probably damaging Het
Proser3 A G 7: 30,539,747 probably null Het
Psmd12 G A 11: 107,479,646 V24M probably damaging Het
Rbm17 A T 2: 11,593,461 M170K probably benign Het
Rims2 C T 15: 39,511,314 T1064I possibly damaging Het
Ripor3 C T 2: 167,992,653 V281M probably damaging Het
Rreb1 C A 13: 37,946,928 Q1353K possibly damaging Het
Sgo2a A G 1: 58,015,806 D383G probably benign Het
Sik3 C T 9: 46,221,148 T1346M probably damaging Het
Slx1b A T 7: 126,692,796 V63E probably damaging Het
Son A G 16: 91,657,086 D907G probably damaging Het
Src G A 2: 157,469,212 V401M probably damaging Het
St3gal4 T C 9: 35,054,757 K24E possibly damaging Het
Stat6 A G 10: 127,658,245 K647R probably damaging Het
Tbl1xr1 G A 3: 22,193,169 probably null Het
Tlk2 G A 11: 105,256,952 probably null Het
Tmbim6 T A 15: 99,401,615 I3K probably benign Het
Tmeff2 A T 1: 51,181,867 I334F probably damaging Het
Ttn T C 2: 76,840,315 probably null Het
Ubl7 T A 9: 57,914,611 I81N probably damaging Het
Ugt1a10 A G 1: 88,055,711 Y77C probably damaging Het
Uqcrfs1 A G 13: 30,540,907 C217R probably damaging Het
Usp50 T C 2: 126,761,634 T331A probably benign Het
Vmn1r65 A G 7: 6,009,157 V26A probably benign Het
Wdfy3 A C 5: 101,917,579 V1241G possibly damaging Het
Wtap A C 17: 12,981,744 probably null Het
Zbtb40 C A 4: 136,984,837 A1187S possibly damaging Het
Zfp57 T C 17: 37,006,098 S20P probably damaging Het
Zfp592 A G 7: 81,024,479 D397G probably damaging Het
Zfp747 A T 7: 127,374,504 S165T probably benign Het
Zfp949 C T 9: 88,569,838 T487I probably damaging Het
Zscan4d A G 7: 11,164,994 C119R probably damaging Het
Other mutations in Olfr366
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Olfr366 APN 2 37220026 missense probably damaging 1.00
IGL01925:Olfr366 APN 2 37220046 missense probably benign 0.14
IGL02355:Olfr366 APN 2 37219669 missense probably damaging 1.00
IGL02362:Olfr366 APN 2 37219669 missense probably damaging 1.00
IGL02671:Olfr366 APN 2 37220245 missense probably damaging 1.00
IGL02821:Olfr366 APN 2 37220100 missense probably damaging 1.00
R0603:Olfr366 UTSW 2 37220106 missense probably damaging 1.00
R0707:Olfr366 UTSW 2 37220196 nonsense probably null
R1204:Olfr366 UTSW 2 37219639 missense probably benign
R1509:Olfr366 UTSW 2 37219954 missense probably damaging 1.00
R1676:Olfr366 UTSW 2 37219641 nonsense probably null
R1823:Olfr366 UTSW 2 37220332 missense probably damaging 0.96
R2163:Olfr366 UTSW 2 37220077 missense probably damaging 1.00
R2909:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R3696:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R3698:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R4004:Olfr366 UTSW 2 37219948 missense probably benign 0.00
R4655:Olfr366 UTSW 2 37219873 missense probably benign 0.03
R5311:Olfr366 UTSW 2 37219621 missense probably benign 0.00
R5385:Olfr366 UTSW 2 37219587 missense possibly damaging 0.77
R5433:Olfr366 UTSW 2 37219672 missense probably damaging 1.00
R5499:Olfr366 UTSW 2 37219765 missense possibly damaging 0.81
R5707:Olfr366 UTSW 2 37219889 missense probably benign 0.00
R6330:Olfr366 UTSW 2 37220124 missense probably benign 0.00
R6338:Olfr366 UTSW 2 37219822 missense probably damaging 1.00
R6666:Olfr366 UTSW 2 37220319 missense probably damaging 1.00
R6872:Olfr366 UTSW 2 37219977 missense possibly damaging 0.60
R7412:Olfr366 UTSW 2 37219762 missense possibly damaging 0.48
R7789:Olfr366 UTSW 2 37219660 missense probably benign 0.01
R7831:Olfr366 UTSW 2 37219711 missense probably damaging 0.98
R8220:Olfr366 UTSW 2 37219779 missense probably benign 0.06
R8391:Olfr366 UTSW 2 37220265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAATGCTCCGGGAAAACCAG -3'
(R):5'- AGGCGACCCATGAGAATTGTGTG -3'

Sequencing Primer
(F):5'- GAGCCACATGACAGAATTCCTC -3'
(R):5'- TTGCAAATAGCAACATAGCGGTC -3'
Posted On2014-03-14