Incidental Mutation 'R1457:Usp50'
ID158542
Institutional Source Beutler Lab
Gene Symbol Usp50
Ensembl Gene ENSMUSG00000027364
Gene Nameubiquitin specific peptidase 50
Synonyms
MMRRC Submission 039512-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1457 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location126709096-126783470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126761634 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 331 (T331A)
Ref Sequence ENSEMBL: ENSMUSP00000028842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028841] [ENSMUST00000028842] [ENSMUST00000110416] [ENSMUST00000130356] [ENSMUST00000136319]
Predicted Effect probably benign
Transcript: ENSMUST00000028841
SMART Domains Protein: ENSMUSP00000028841
Gene: ENSMUSG00000027363

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 116 2.3e-37 PFAM
low complexity region 119 140 N/A INTRINSIC
RHOD 185 310 3.69e-7 SMART
low complexity region 378 393 N/A INTRINSIC
coiled coil region 467 501 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
Pfam:UCH 738 1068 4e-88 PFAM
Pfam:UCH_1 739 1053 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028842
AA Change: T331A

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028842
Gene: ENSMUSG00000027364
AA Change: T331A

DomainStartEndE-ValueType
Pfam:UCH 44 360 9.2e-67 PFAM
Pfam:UCH_1 45 342 2.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110416
SMART Domains Protein: ENSMUSP00000106046
Gene: ENSMUSG00000027363

DomainStartEndE-ValueType
Pfam:USP8_dimer 6 127 2.5e-36 PFAM
low complexity region 130 151 N/A INTRINSIC
RHOD 196 321 3.69e-7 SMART
low complexity region 389 404 N/A INTRINSIC
coiled coil region 478 512 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Pfam:UCH 749 1079 1.3e-82 PFAM
Pfam:UCH_1 750 1064 3.7e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000130356
AA Change: T270A
SMART Domains Protein: ENSMUSP00000116873
Gene: ENSMUSG00000027364
AA Change: T270A

DomainStartEndE-ValueType
Pfam:UCH 8 183 1.5e-20 PFAM
Pfam:UCH_1 22 194 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136319
SMART Domains Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 1 268 1.9e-39 PFAM
Pfam:UCH_1 1 269 1.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145194
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,626,012 Y268* probably null Het
Abca14 A T 7: 120,289,460 I1210F probably benign Het
Ankrd17 T C 5: 90,285,846 H688R possibly damaging Het
Arhgap24 T A 5: 102,664,106 N66K probably damaging Het
Atp1a1 C T 3: 101,590,466 G335D probably damaging Het
Cacna1g C T 11: 94,459,555 R488H possibly damaging Het
Cacna1h A T 17: 25,397,620 V149E probably damaging Het
Cd22 G T 7: 30,873,170 P338Q probably benign Het
Cntln G T 4: 85,096,839 M1122I probably benign Het
Cntrl A G 2: 35,122,756 N302S probably benign Het
Cog8 T C 8: 107,052,896 R250G probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Cyp2b23 G A 7: 26,673,149 P347L probably damaging Het
Dnah5 T C 15: 28,403,542 probably null Het
Eml6 C T 11: 30,024,459 V40I probably damaging Het
Epb42 C T 2: 121,029,967 probably null Het
Fcrla A G 1: 170,921,004 L190P probably damaging Het
Galnt18 A T 7: 111,779,428 Y40* probably null Het
Gdf7 A T 12: 8,298,073 M416K probably damaging Het
Gm11232 T A 4: 71,756,919 probably null Het
Gpam T A 19: 55,088,176 N198Y probably damaging Het
Grip1 C T 10: 119,986,350 S327F possibly damaging Het
Hey2 C T 10: 30,834,356 A134T probably benign Het
Kat6a T C 8: 22,938,652 I1341T probably benign Het
Kcnd3 T C 3: 105,668,186 L542P probably benign Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lman2 T C 13: 55,351,251 D234G probably benign Het
Map3k19 A C 1: 127,817,898 I1273R probably damaging Het
Matn1 T A 4: 130,950,019 F180I possibly damaging Het
Meikin T A 11: 54,370,941 L61* probably null Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Myh13 T C 11: 67,331,046 I199T probably damaging Het
Myh4 T A 11: 67,248,461 S535T probably damaging Het
Myo5a T C 9: 75,213,065 M1715T probably damaging Het
Nat8 A T 6: 85,830,989 V54D probably damaging Het
Nbea A G 3: 56,085,327 V286A probably damaging Het
Ndnf A G 6: 65,704,014 K426E possibly damaging Het
Nup210l T A 3: 90,190,972 N1410K possibly damaging Het
Oca2 A T 7: 56,321,521 T399S probably damaging Het
Olfr1045 A G 2: 86,198,252 S167P probably damaging Het
Olfr118 A T 17: 37,672,925 K301* probably null Het
Olfr250 G A 9: 38,368,196 V217I probably benign Het
Olfr366 A C 2: 37,219,659 T57P possibly damaging Het
Olfr644 A T 7: 104,068,459 C191S probably damaging Het
Olfr652 T A 7: 104,565,071 N283K probably damaging Het
Otogl A C 10: 107,878,152 probably null Het
Pde4b C T 4: 102,605,176 T511I probably damaging Het
Proser3 A G 7: 30,539,747 probably null Het
Psmd12 G A 11: 107,479,646 V24M probably damaging Het
Rbm17 A T 2: 11,593,461 M170K probably benign Het
Rims2 C T 15: 39,511,314 T1064I possibly damaging Het
Ripor3 C T 2: 167,992,653 V281M probably damaging Het
Rreb1 C A 13: 37,946,928 Q1353K possibly damaging Het
Sgo2a A G 1: 58,015,806 D383G probably benign Het
Sik3 C T 9: 46,221,148 T1346M probably damaging Het
Slx1b A T 7: 126,692,796 V63E probably damaging Het
Son A G 16: 91,657,086 D907G probably damaging Het
Src G A 2: 157,469,212 V401M probably damaging Het
St3gal4 T C 9: 35,054,757 K24E possibly damaging Het
Stat6 A G 10: 127,658,245 K647R probably damaging Het
Tbl1xr1 G A 3: 22,193,169 probably null Het
Tlk2 G A 11: 105,256,952 probably null Het
Tmbim6 T A 15: 99,401,615 I3K probably benign Het
Tmeff2 A T 1: 51,181,867 I334F probably damaging Het
Ttn T C 2: 76,840,315 probably null Het
Ubl7 T A 9: 57,914,611 I81N probably damaging Het
Ugt1a10 A G 1: 88,055,711 Y77C probably damaging Het
Uqcrfs1 A G 13: 30,540,907 C217R probably damaging Het
Vmn1r65 A G 7: 6,009,157 V26A probably benign Het
Wdfy3 A C 5: 101,917,579 V1241G possibly damaging Het
Wtap A C 17: 12,981,744 probably null Het
Zbtb40 C A 4: 136,984,837 A1187S possibly damaging Het
Zfp57 T C 17: 37,006,098 S20P probably damaging Het
Zfp592 A G 7: 81,024,479 D397G probably damaging Het
Zfp747 A T 7: 127,374,504 S165T probably benign Het
Zfp949 C T 9: 88,569,838 T487I probably damaging Het
Zscan4d A G 7: 11,164,994 C119R probably damaging Het
Other mutations in Usp50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Usp50 APN 2 126709414 missense probably damaging 0.98
IGL01565:Usp50 APN 2 126777968 nonsense probably null
IGL01976:Usp50 APN 2 126709466 missense probably benign 0.10
IGL02192:Usp50 APN 2 126778038 missense possibly damaging 0.94
IGL02272:Usp50 APN 2 126769944 missense probably damaging 0.98
IGL02892:Usp50 APN 2 126769902 missense probably damaging 1.00
PIT4453001:Usp50 UTSW 2 126783316 start gained probably benign
R0034:Usp50 UTSW 2 126777975 missense possibly damaging 0.89
R0382:Usp50 UTSW 2 126777928 missense probably damaging 1.00
R0433:Usp50 UTSW 2 126761544 missense probably damaging 0.98
R1146:Usp50 UTSW 2 126709472 missense probably benign 0.02
R1475:Usp50 UTSW 2 126769867 splice site probably null
R1758:Usp50 UTSW 2 126775862 missense probably damaging 1.00
R1889:Usp50 UTSW 2 126777898 critical splice donor site probably null
R1940:Usp50 UTSW 2 126778023 missense probably benign 0.03
R1959:Usp50 UTSW 2 126777961 missense possibly damaging 0.91
R2698:Usp50 UTSW 2 126778029 missense probably damaging 0.97
R4648:Usp50 UTSW 2 126778033 missense probably damaging 0.98
R4809:Usp50 UTSW 2 126777853 intron probably benign
R6247:Usp50 UTSW 2 126775793 missense probably benign 0.33
R7030:Usp50 UTSW 2 126780475 missense possibly damaging 0.78
R7186:Usp50 UTSW 2 126783298 start gained probably benign
R7522:Usp50 UTSW 2 126783226 missense probably damaging 1.00
R8110:Usp50 UTSW 2 126780330 splice site probably null
X0064:Usp50 UTSW 2 126761646 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCACTTTCGGATAGCTTGCTTGC -3'
(R):5'- CCACACATGGAGGGTCACAACTTAG -3'

Sequencing Primer
(F):5'- CAGTGGTCAGGAGTACTGTCC -3'
(R):5'- GGTCACAACTTAGAACTCCAGTTAG -3'
Posted On2014-03-14