Incidental Mutation 'R1457:Tbl1xr1'
ID158546
Institutional Source Beutler Lab
Gene Symbol Tbl1xr1
Ensembl Gene ENSMUSG00000027630
Gene Nametransducin (beta)-like 1X-linked receptor 1
Synonyms8030499H02Rik, Ira1, DC42, A630076E03Rik, C21, C230089I12Rik, TBLR1
MMRRC Submission 039512-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R1457 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location22076652-22216594 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 22193169 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063988] [ENSMUST00000192328] [ENSMUST00000193734] [ENSMUST00000200793] [ENSMUST00000200943] [ENSMUST00000201509] [ENSMUST00000202356] [ENSMUST00000202747]
Predicted Effect probably null
Transcript: ENSMUST00000063988
SMART Domains Protein: ENSMUSP00000067164
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192328
SMART Domains Protein: ENSMUSP00000141363
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193734
SMART Domains Protein: ENSMUSP00000142184
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200793
SMART Domains Protein: ENSMUSP00000144138
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
low complexity region 124 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200943
SMART Domains Protein: ENSMUSP00000144602
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201509
SMART Domains Protein: ENSMUSP00000144547
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 3.2e-10 SMART
WD40 208 253 6.2e-7 SMART
WD40 255 294 2.9e-9 SMART
WD40 297 335 4.5e-5 SMART
WD40 338 377 5.9e-15 SMART
WD40 380 428 1.1e-11 SMART
WD40 431 470 2.1e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202149
Predicted Effect probably benign
Transcript: ENSMUST00000202356
SMART Domains Protein: ENSMUSP00000144301
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202647
Predicted Effect probably null
Transcript: ENSMUST00000202747
SMART Domains Protein: ENSMUSP00000144436
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WD40 repeat-containing gene family and shares sequence similarity with transducin (beta)-like 1X-linked (TBL1X). The protein encoded by this gene is thought to be a component of both nuclear receptor corepressor (N-CoR) and histone deacetylase 3 (HDAC 3) complexes, and is required for transcriptional activation by a variety of transcription factors. Mutations in these gene have been associated with some autism spectrum disorders, and one finding suggests that haploinsufficiency of this gene may be a cause of intellectual disability with dysmorphism. Mutations in this gene as well as recurrent translocations involving this gene have also been observed in some tumors. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in adipose tissue exhibit increased body weight, and total body fat and increased susceptibility to diet-induced obesity and impaired glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,626,012 Y268* probably null Het
Abca14 A T 7: 120,289,460 I1210F probably benign Het
Ankrd17 T C 5: 90,285,846 H688R possibly damaging Het
Arhgap24 T A 5: 102,664,106 N66K probably damaging Het
Atp1a1 C T 3: 101,590,466 G335D probably damaging Het
Cacna1g C T 11: 94,459,555 R488H possibly damaging Het
Cacna1h A T 17: 25,397,620 V149E probably damaging Het
Cd22 G T 7: 30,873,170 P338Q probably benign Het
Cntln G T 4: 85,096,839 M1122I probably benign Het
Cntrl A G 2: 35,122,756 N302S probably benign Het
Cog8 T C 8: 107,052,896 R250G probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Cyp2b23 G A 7: 26,673,149 P347L probably damaging Het
Dnah5 T C 15: 28,403,542 probably null Het
Eml6 C T 11: 30,024,459 V40I probably damaging Het
Epb42 C T 2: 121,029,967 probably null Het
Fcrla A G 1: 170,921,004 L190P probably damaging Het
Galnt18 A T 7: 111,779,428 Y40* probably null Het
Gdf7 A T 12: 8,298,073 M416K probably damaging Het
Gm11232 T A 4: 71,756,919 probably null Het
Gpam T A 19: 55,088,176 N198Y probably damaging Het
Grip1 C T 10: 119,986,350 S327F possibly damaging Het
Hey2 C T 10: 30,834,356 A134T probably benign Het
Kat6a T C 8: 22,938,652 I1341T probably benign Het
Kcnd3 T C 3: 105,668,186 L542P probably benign Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lman2 T C 13: 55,351,251 D234G probably benign Het
Map3k19 A C 1: 127,817,898 I1273R probably damaging Het
Matn1 T A 4: 130,950,019 F180I possibly damaging Het
Meikin T A 11: 54,370,941 L61* probably null Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Myh13 T C 11: 67,331,046 I199T probably damaging Het
Myh4 T A 11: 67,248,461 S535T probably damaging Het
Myo5a T C 9: 75,213,065 M1715T probably damaging Het
Nat8 A T 6: 85,830,989 V54D probably damaging Het
Nbea A G 3: 56,085,327 V286A probably damaging Het
Ndnf A G 6: 65,704,014 K426E possibly damaging Het
Nup210l T A 3: 90,190,972 N1410K possibly damaging Het
Oca2 A T 7: 56,321,521 T399S probably damaging Het
Olfr1045 A G 2: 86,198,252 S167P probably damaging Het
Olfr118 A T 17: 37,672,925 K301* probably null Het
Olfr250 G A 9: 38,368,196 V217I probably benign Het
Olfr366 A C 2: 37,219,659 T57P possibly damaging Het
Olfr644 A T 7: 104,068,459 C191S probably damaging Het
Olfr652 T A 7: 104,565,071 N283K probably damaging Het
Otogl A C 10: 107,878,152 probably null Het
Pde4b C T 4: 102,605,176 T511I probably damaging Het
Proser3 A G 7: 30,539,747 probably null Het
Psmd12 G A 11: 107,479,646 V24M probably damaging Het
Rbm17 A T 2: 11,593,461 M170K probably benign Het
Rims2 C T 15: 39,511,314 T1064I possibly damaging Het
Ripor3 C T 2: 167,992,653 V281M probably damaging Het
Rreb1 C A 13: 37,946,928 Q1353K possibly damaging Het
Sgo2a A G 1: 58,015,806 D383G probably benign Het
Sik3 C T 9: 46,221,148 T1346M probably damaging Het
Slx1b A T 7: 126,692,796 V63E probably damaging Het
Son A G 16: 91,657,086 D907G probably damaging Het
Src G A 2: 157,469,212 V401M probably damaging Het
St3gal4 T C 9: 35,054,757 K24E possibly damaging Het
Stat6 A G 10: 127,658,245 K647R probably damaging Het
Tlk2 G A 11: 105,256,952 probably null Het
Tmbim6 T A 15: 99,401,615 I3K probably benign Het
Tmeff2 A T 1: 51,181,867 I334F probably damaging Het
Ttn T C 2: 76,840,315 probably null Het
Ubl7 T A 9: 57,914,611 I81N probably damaging Het
Ugt1a10 A G 1: 88,055,711 Y77C probably damaging Het
Uqcrfs1 A G 13: 30,540,907 C217R probably damaging Het
Usp50 T C 2: 126,761,634 T331A probably benign Het
Vmn1r65 A G 7: 6,009,157 V26A probably benign Het
Wdfy3 A C 5: 101,917,579 V1241G possibly damaging Het
Wtap A C 17: 12,981,744 probably null Het
Zbtb40 C A 4: 136,984,837 A1187S possibly damaging Het
Zfp57 T C 17: 37,006,098 S20P probably damaging Het
Zfp592 A G 7: 81,024,479 D397G probably damaging Het
Zfp747 A T 7: 127,374,504 S165T probably benign Het
Zfp949 C T 9: 88,569,838 T487I probably damaging Het
Zscan4d A G 7: 11,164,994 C119R probably damaging Het
Other mutations in Tbl1xr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tbl1xr1 APN 3 22192268 critical splice donor site probably null
IGL00825:Tbl1xr1 APN 3 22189786 splice site probably null
IGL01622:Tbl1xr1 APN 3 22192074 missense probably benign 0.01
IGL01623:Tbl1xr1 APN 3 22192074 missense probably benign 0.01
IGL01717:Tbl1xr1 APN 3 22193171 splice site probably benign
IGL02421:Tbl1xr1 APN 3 22203163 missense probably damaging 0.99
IGL03117:Tbl1xr1 APN 3 22203159 nonsense probably null
R0076:Tbl1xr1 UTSW 3 22189785 missense probably benign 0.06
R0601:Tbl1xr1 UTSW 3 22179319 splice site probably benign
R0629:Tbl1xr1 UTSW 3 22210401 missense probably benign 0.41
R0654:Tbl1xr1 UTSW 3 22203994 critical splice donor site probably null
R0811:Tbl1xr1 UTSW 3 22200587 splice site probably benign
R1496:Tbl1xr1 UTSW 3 22190951 missense possibly damaging 0.68
R1914:Tbl1xr1 UTSW 3 22190910 splice site probably benign
R2680:Tbl1xr1 UTSW 3 22191451 missense possibly damaging 0.76
R3929:Tbl1xr1 UTSW 3 22189768 missense probably damaging 1.00
R4193:Tbl1xr1 UTSW 3 22200358 missense possibly damaging 0.90
R4440:Tbl1xr1 UTSW 3 22200588 critical splice acceptor site probably null
R4642:Tbl1xr1 UTSW 3 22188420 missense probably damaging 1.00
R5187:Tbl1xr1 UTSW 3 22209606 missense probably damaging 1.00
R5361:Tbl1xr1 UTSW 3 22192069 missense probably damaging 0.97
R5430:Tbl1xr1 UTSW 3 22192082 missense probably benign 0.01
R5710:Tbl1xr1 UTSW 3 22210414 missense probably damaging 0.99
R6490:Tbl1xr1 UTSW 3 22203977 missense probably damaging 0.97
R6512:Tbl1xr1 UTSW 3 22140534 intron probably benign
R6778:Tbl1xr1 UTSW 3 22189782 missense probably benign 0.00
R6861:Tbl1xr1 UTSW 3 22191439 missense possibly damaging 0.68
R6861:Tbl1xr1 UTSW 3 22191539 splice site probably null
R6878:Tbl1xr1 UTSW 3 22203204 missense possibly damaging 0.90
R6998:Tbl1xr1 UTSW 3 22179290 missense probably damaging 1.00
R7409:Tbl1xr1 UTSW 3 22203190 missense possibly damaging 0.56
R8029:Tbl1xr1 UTSW 3 22200436 missense probably damaging 0.98
X0011:Tbl1xr1 UTSW 3 22203092 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAGTTCACTACACAGCATCCTTCCG -3'
(R):5'- TGCCCAGGGTACTTCCTGTACATC -3'

Sequencing Primer
(F):5'- GCCTTGATACAGTCAGGTGTCC -3'
(R):5'- tgctaccctcgctccatc -3'
Posted On2014-03-14