Incidental Mutation 'R1457:Nup210l'
ID 158548
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
MMRRC Submission 039512-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock # R1457 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 90104132-90212048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90190972 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 1410 (N1410K)
Ref Sequence ENSEMBL: ENSMUSP00000143368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect possibly damaging
Transcript: ENSMUST00000029548
AA Change: N1410K

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: N1410K

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200410
AA Change: N1410K

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: N1410K

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,626,012 Y268* probably null Het
Abca14 A T 7: 120,289,460 I1210F probably benign Het
Ankrd17 T C 5: 90,285,846 H688R possibly damaging Het
Arhgap24 T A 5: 102,664,106 N66K probably damaging Het
Atp1a1 C T 3: 101,590,466 G335D probably damaging Het
Cacna1g C T 11: 94,459,555 R488H possibly damaging Het
Cacna1h A T 17: 25,397,620 V149E probably damaging Het
Cd22 G T 7: 30,873,170 P338Q probably benign Het
Cntln G T 4: 85,096,839 M1122I probably benign Het
Cntrl A G 2: 35,122,756 N302S probably benign Het
Cog8 T C 8: 107,052,896 R250G probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Cyp2b23 G A 7: 26,673,149 P347L probably damaging Het
Dnah5 T C 15: 28,403,542 probably null Het
Eml6 C T 11: 30,024,459 V40I probably damaging Het
Epb42 C T 2: 121,029,967 probably null Het
Fcrla A G 1: 170,921,004 L190P probably damaging Het
Galnt18 A T 7: 111,779,428 Y40* probably null Het
Gdf7 A T 12: 8,298,073 M416K probably damaging Het
Gm11232 T A 4: 71,756,919 probably null Het
Gpam T A 19: 55,088,176 N198Y probably damaging Het
Grip1 C T 10: 119,986,350 S327F possibly damaging Het
Hey2 C T 10: 30,834,356 A134T probably benign Het
Kat6a T C 8: 22,938,652 I1341T probably benign Het
Kcnd3 T C 3: 105,668,186 L542P probably benign Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lman2 T C 13: 55,351,251 D234G probably benign Het
Map3k19 A C 1: 127,817,898 I1273R probably damaging Het
Matn1 T A 4: 130,950,019 F180I possibly damaging Het
Meikin T A 11: 54,370,941 L61* probably null Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Myh13 T C 11: 67,331,046 I199T probably damaging Het
Myh4 T A 11: 67,248,461 S535T probably damaging Het
Myo5a T C 9: 75,213,065 M1715T probably damaging Het
Nat8 A T 6: 85,830,989 V54D probably damaging Het
Nbea A G 3: 56,085,327 V286A probably damaging Het
Ndnf A G 6: 65,704,014 K426E possibly damaging Het
Oca2 A T 7: 56,321,521 T399S probably damaging Het
Olfr1045 A G 2: 86,198,252 S167P probably damaging Het
Olfr118 A T 17: 37,672,925 K301* probably null Het
Olfr250 G A 9: 38,368,196 V217I probably benign Het
Olfr366 A C 2: 37,219,659 T57P possibly damaging Het
Olfr644 A T 7: 104,068,459 C191S probably damaging Het
Olfr652 T A 7: 104,565,071 N283K probably damaging Het
Otogl A C 10: 107,878,152 probably null Het
Pde4b C T 4: 102,605,176 T511I probably damaging Het
Proser3 A G 7: 30,539,747 probably null Het
Psmd12 G A 11: 107,479,646 V24M probably damaging Het
Rbm17 A T 2: 11,593,461 M170K probably benign Het
Rims2 C T 15: 39,511,314 T1064I possibly damaging Het
Ripor3 C T 2: 167,992,653 V281M probably damaging Het
Rreb1 C A 13: 37,946,928 Q1353K possibly damaging Het
Sgo2a A G 1: 58,015,806 D383G probably benign Het
Sik3 C T 9: 46,221,148 T1346M probably damaging Het
Slx1b A T 7: 126,692,796 V63E probably damaging Het
Son A G 16: 91,657,086 D907G probably damaging Het
Src G A 2: 157,469,212 V401M probably damaging Het
St3gal4 T C 9: 35,054,757 K24E possibly damaging Het
Stat6 A G 10: 127,658,245 K647R probably damaging Het
Tbl1xr1 G A 3: 22,193,169 probably null Het
Tlk2 G A 11: 105,256,952 probably null Het
Tmbim6 T A 15: 99,401,615 I3K probably benign Het
Tmeff2 A T 1: 51,181,867 I334F probably damaging Het
Ttn T C 2: 76,840,315 probably null Het
Ubl7 T A 9: 57,914,611 I81N probably damaging Het
Ugt1a10 A G 1: 88,055,711 Y77C probably damaging Het
Uqcrfs1 A G 13: 30,540,907 C217R probably damaging Het
Usp50 T C 2: 126,761,634 T331A probably benign Het
Vmn1r65 A G 7: 6,009,157 V26A probably benign Het
Wdfy3 A C 5: 101,917,579 V1241G possibly damaging Het
Wtap A C 17: 12,981,744 probably null Het
Zbtb40 C A 4: 136,984,837 A1187S possibly damaging Het
Zfp57 T C 17: 37,006,098 S20P probably damaging Het
Zfp592 A G 7: 81,024,479 D397G probably damaging Het
Zfp747 A T 7: 127,374,504 S165T probably benign Het
Zfp949 C T 9: 88,569,838 T487I probably damaging Het
Zscan4d A G 7: 11,164,994 C119R probably damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 splice site probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
R7450:Nup210l UTSW 3 90115188 critical splice donor site probably null
R7514:Nup210l UTSW 3 90210459 critical splice donor site probably null
R7658:Nup210l UTSW 3 90211993 missense probably benign 0.43
R7735:Nup210l UTSW 3 90185576 missense probably damaging 1.00
R7772:Nup210l UTSW 3 90159926 missense probably damaging 1.00
R7800:Nup210l UTSW 3 90134597 missense probably damaging 1.00
R7840:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7847:Nup210l UTSW 3 90151123 missense probably benign
R7848:Nup210l UTSW 3 90203905 missense probably benign 0.01
R8084:Nup210l UTSW 3 90136058 missense probably benign 0.15
R8121:Nup210l UTSW 3 90115121 missense probably damaging 1.00
R8421:Nup210l UTSW 3 90203867 missense probably damaging 1.00
R8458:Nup210l UTSW 3 90185567 missense probably null 1.00
R8701:Nup210l UTSW 3 90122814 missense probably benign 0.41
R8720:Nup210l UTSW 3 90210374 missense probably benign 0.00
R8770:Nup210l UTSW 3 90118543 missense probably damaging 1.00
R8896:Nup210l UTSW 3 90118625 missense probably damaging 1.00
R9033:Nup210l UTSW 3 90198089 missense probably benign
R9371:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9373:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9381:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9426:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9427:Nup210l UTSW 3 90199866 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCAGCTTGAATAATGAAGCAGCC -3'
(R):5'- AAGAGGAATCTGCTGAAACTGCCGC -3'

Sequencing Primer
(F):5'- tccccagaacccatagaagag -3'
(R):5'- TGCCGCAGAACACTGAG -3'
Posted On 2014-03-14