Mutagenetix > Incidental Mutation

Incidental Mutation 'R1457:Atp1a1'

158549

Institutional Source

Beutler Lab

Gene Symbol

Atp1a1

Ensembl Gene

ENSMUSG00000033161

Gene Name

ATPase, Na+/K+ transporting, alpha 1 polypeptide

Synonyms

Atpa-1

MMRRC Submission

039512-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1457 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

101576219-101604684 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101590466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 335 (G335D)

Ref Sequence

ENSEMBL: ENSMUSP00000039657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036493]

AlphaFold

Q8VDN2

Predicted Effect

probably damaging
Transcript: ENSMUST00000036493
AA Change: G335D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: G335D

Domain	Start	End	E-Value	Type
low complexity region	21	28	N/A	INTRINSIC
Cation_ATPase_N	42	116	5e-20	SMART
Pfam:E1-E2_ATPase	134	365	1.6e-59	PFAM
Pfam:Hydrolase	370	729	2.7e-19	PFAM
Pfam:HAD	373	726	1.3e-18	PFAM
Pfam:Cation_ATPase	426	521	2.2e-25	PFAM
Pfam:Cation_ATPase_C	799	1008	1.2e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136340

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,626,012	Y268*	probably null	Het
Abca14	A	T	7: 120,289,460	I1210F	probably benign	Het
Ankrd17	T	C	5: 90,285,846	H688R	possibly damaging	Het
Arhgap24	T	A	5: 102,664,106	N66K	probably damaging	Het
Cacna1g	C	T	11: 94,459,555	R488H	possibly damaging	Het
Cacna1h	A	T	17: 25,397,620	V149E	probably damaging	Het
Cd22	G	T	7: 30,873,170	P338Q	probably benign	Het
Cntln	G	T	4: 85,096,839	M1122I	probably benign	Het
Cntrl	A	G	2: 35,122,756	N302S	probably benign	Het
Cog8	T	C	8: 107,052,896	R250G	probably damaging	Het
Creld2	T	C	15: 88,823,753	C232R	probably damaging	Het
Cyp2b23	G	A	7: 26,673,149	P347L	probably damaging	Het
Dnah5	T	C	15: 28,403,542		probably null	Het
Eml6	C	T	11: 30,024,459	V40I	probably damaging	Het
Epb42	C	T	2: 121,029,967		probably null	Het
Fcrla	A	G	1: 170,921,004	L190P	probably damaging	Het
Galnt18	A	T	7: 111,779,428	Y40*	probably null	Het
Gdf7	A	T	12: 8,298,073	M416K	probably damaging	Het
Gm11232	T	A	4: 71,756,919		probably null	Het
Gpam	T	A	19: 55,088,176	N198Y	probably damaging	Het
Grip1	C	T	10: 119,986,350	S327F	possibly damaging	Het
Hey2	C	T	10: 30,834,356	A134T	probably benign	Het
Kat6a	T	C	8: 22,938,652	I1341T	probably benign	Het
Kcnd3	T	C	3: 105,668,186	L542P	probably benign	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lman2	T	C	13: 55,351,251	D234G	probably benign	Het
Map3k19	A	C	1: 127,817,898	I1273R	probably damaging	Het
Matn1	T	A	4: 130,950,019	F180I	possibly damaging	Het
Meikin	T	A	11: 54,370,941	L61*	probably null	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Myh13	T	C	11: 67,331,046	I199T	probably damaging	Het
Myh4	T	A	11: 67,248,461	S535T	probably damaging	Het
Myo5a	T	C	9: 75,213,065	M1715T	probably damaging	Het
Nat8	A	T	6: 85,830,989	V54D	probably damaging	Het
Nbea	A	G	3: 56,085,327	V286A	probably damaging	Het
Ndnf	A	G	6: 65,704,014	K426E	possibly damaging	Het
Nup210l	T	A	3: 90,190,972	N1410K	possibly damaging	Het
Oca2	A	T	7: 56,321,521	T399S	probably damaging	Het
Olfr1045	A	G	2: 86,198,252	S167P	probably damaging	Het
Olfr118	A	T	17: 37,672,925	K301*	probably null	Het
Olfr250	G	A	9: 38,368,196	V217I	probably benign	Het
Olfr366	A	C	2: 37,219,659	T57P	possibly damaging	Het
Olfr644	A	T	7: 104,068,459	C191S	probably damaging	Het
Olfr652	T	A	7: 104,565,071	N283K	probably damaging	Het
Otogl	A	C	10: 107,878,152		probably null	Het
Pde4b	C	T	4: 102,605,176	T511I	probably damaging	Het
Proser3	A	G	7: 30,539,747		probably null	Het
Psmd12	G	A	11: 107,479,646	V24M	probably damaging	Het
Rbm17	A	T	2: 11,593,461	M170K	probably benign	Het
Rims2	C	T	15: 39,511,314	T1064I	possibly damaging	Het
Ripor3	C	T	2: 167,992,653	V281M	probably damaging	Het
Rreb1	C	A	13: 37,946,928	Q1353K	possibly damaging	Het
Sgo2a	A	G	1: 58,015,806	D383G	probably benign	Het
Sik3	C	T	9: 46,221,148	T1346M	probably damaging	Het
Slx1b	A	T	7: 126,692,796	V63E	probably damaging	Het
Son	A	G	16: 91,657,086	D907G	probably damaging	Het
Src	G	A	2: 157,469,212	V401M	probably damaging	Het
St3gal4	T	C	9: 35,054,757	K24E	possibly damaging	Het
Stat6	A	G	10: 127,658,245	K647R	probably damaging	Het
Tbl1xr1	G	A	3: 22,193,169		probably null	Het
Tlk2	G	A	11: 105,256,952		probably null	Het
Tmbim6	T	A	15: 99,401,615	I3K	probably benign	Het
Tmeff2	A	T	1: 51,181,867	I334F	probably damaging	Het
Ttn	T	C	2: 76,840,315		probably null	Het
Ubl7	T	A	9: 57,914,611	I81N	probably damaging	Het
Ugt1a10	A	G	1: 88,055,711	Y77C	probably damaging	Het
Uqcrfs1	A	G	13: 30,540,907	C217R	probably damaging	Het
Usp50	T	C	2: 126,761,634	T331A	probably benign	Het
Vmn1r65	A	G	7: 6,009,157	V26A	probably benign	Het
Wdfy3	A	C	5: 101,917,579	V1241G	possibly damaging	Het
Wtap	A	C	17: 12,981,744		probably null	Het
Zbtb40	C	A	4: 136,984,837	A1187S	possibly damaging	Het
Zfp57	T	C	17: 37,006,098	S20P	probably damaging	Het
Zfp592	A	G	7: 81,024,479	D397G	probably damaging	Het
Zfp747	A	T	7: 127,374,504	S165T	probably benign	Het
Zfp949	C	T	9: 88,569,838	T487I	probably damaging	Het
Zscan4d	A	G	7: 11,164,994	C119R	probably damaging	Het

Other mutations in Atp1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01396:Atp1a1	APN	3	101591453	missense	probably damaging	1.00
IGL01700:Atp1a1	APN	3	101594258	missense	possibly damaging	0.95
IGL01836:Atp1a1	APN	3	101591414	missense	probably damaging	1.00
IGL01863:Atp1a1	APN	3	101591889	nonsense	probably null
IGL02021:Atp1a1	APN	3	101594208	missense	probably benign	0.02
IGL02078:Atp1a1	APN	3	101591863	missense	probably damaging	1.00
IGL02873:Atp1a1	APN	3	101576578	missense	probably benign	0.16
IGL02934:Atp1a1	APN	3	101576992	nonsense	probably null
IGL03068:Atp1a1	APN	3	101583859	missense	probably benign	0.26
PIT4453001:Atp1a1	UTSW	3	101581179	missense	probably benign	0.01
R0009:Atp1a1	UTSW	3	101579835	missense	possibly damaging	0.67
R0506:Atp1a1	UTSW	3	101589812	missense	probably damaging	0.96
R0724:Atp1a1	UTSW	3	101592439	missense	possibly damaging	0.50
R0826:Atp1a1	UTSW	3	101584853	missense	probably damaging	0.99
R1732:Atp1a1	UTSW	3	101584799	missense	probably damaging	1.00
R1843:Atp1a1	UTSW	3	101582017	missense	probably benign	0.43
R2172:Atp1a1	UTSW	3	101590548	missense	probably benign
R3770:Atp1a1	UTSW	3	101581194	missense	probably benign	0.17
R3905:Atp1a1	UTSW	3	101590612	missense	probably benign	0.00
R4602:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4611:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4715:Atp1a1	UTSW	3	101591806	missense	possibly damaging	0.90
R4777:Atp1a1	UTSW	3	101594996	critical splice donor site	probably null
R4795:Atp1a1	UTSW	3	101583775	missense	probably benign	0.15
R5030:Atp1a1	UTSW	3	101579817	missense	probably benign	0.22
R5066:Atp1a1	UTSW	3	101582104	missense	probably damaging	0.98
R5165:Atp1a1	UTSW	3	101581789	missense	probably benign	0.01
R5297:Atp1a1	UTSW	3	101591127	missense	possibly damaging	0.82
R5307:Atp1a1	UTSW	3	101589964	missense	probably damaging	1.00
R5379:Atp1a1	UTSW	3	101582095	missense	probably benign	0.01
R5495:Atp1a1	UTSW	3	101591425	missense	probably benign	0.01
R5946:Atp1a1	UTSW	3	101589774	missense	probably benign	0.12
R6125:Atp1a1	UTSW	3	101590707	missense	probably damaging	1.00
R6789:Atp1a1	UTSW	3	101586298	missense	possibly damaging	0.71
R7339:Atp1a1	UTSW	3	101589872	missense	probably benign	0.44
R7552:Atp1a1	UTSW	3	101582121	nonsense	probably null
R7825:Atp1a1	UTSW	3	101586169	missense	probably benign	0.00
R8098:Atp1a1	UTSW	3	101582049	missense	probably damaging	0.97
R8175:Atp1a1	UTSW	3	101584854	missense	possibly damaging	0.79
R8281:Atp1a1	UTSW	3	101579624	missense	probably benign	0.12
R8403:Atp1a1	UTSW	3	101586904	missense	probably damaging	1.00
R8435:Atp1a1	UTSW	3	101582762	missense	probably benign
R8461:Atp1a1	UTSW	3	101589089	missense	probably benign	0.01
R8772:Atp1a1	UTSW	3	101579808	missense	probably benign
R8782:Atp1a1	UTSW	3	101594217	missense	possibly damaging	0.63
R8919:Atp1a1	UTSW	3	101591231	missense	probably damaging	1.00
R9066:Atp1a1	UTSW	3	101582022	missense	probably damaging	1.00
R9227:Atp1a1	UTSW	3	101592434	missense	probably damaging	1.00
R9712:Atp1a1	UTSW	3	101591441	missense	probably benign	0.06
X0019:Atp1a1	UTSW	3	101594213	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CATGTGATGTGGAATCAAAGACTGCAC -3'
(R):5'- GAAACCAAGCACATTTTCTGGCCTC -3'

Sequencing Primer
(F):5'- TGCACAGAAATAAATATAGACGTTGG -3'
(R):5'- TGATGGGCAGGATTGCCAC -3'

Posted On

2014-03-14