Mutagenetix > Incidental Mutation

Incidental Mutation 'R1457:Arhgap24'

158559

Institutional Source

Beutler Lab

Gene Symbol

Arhgap24

Ensembl Gene

ENSMUSG00000057315

Gene Name

Rho GTPase activating protein 24

Synonyms

0610025G21Rik

MMRRC Submission

039512-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1457 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102481391-102897937 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102664106 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 66 (N66K)

Ref Sequence

ENSEMBL: ENSMUSP00000092138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112854]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000073302

SMART Domains

Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	38	5e-16	BLAST
RhoGAP	55	231	7.04e-67	SMART
low complexity region	473	484	N/A	INTRINSIC
low complexity region	517	536	N/A	INTRINSIC
coiled coil region	555	635	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000094559
AA Change: N66K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315
AA Change: N66K

Domain	Start	End	E-Value	Type
PH	18	125	5.35e-23	SMART
RhoGAP	148	324	7.04e-67	SMART
low complexity region	566	577	N/A	INTRINSIC
low complexity region	610	629	N/A	INTRINSIC
coiled coil region	648	728	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112854

SMART Domains

Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315

Domain	Start	End	E-Value	Type
Blast:RhoGAP	1	38	5e-16	BLAST
RhoGAP	55	231	7.04e-67	SMART
low complexity region	473	484	N/A	INTRINSIC
low complexity region	517	536	N/A	INTRINSIC
coiled coil region	555	635	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126125

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,626,012	Y268*	probably null	Het
Abca14	A	T	7: 120,289,460	I1210F	probably benign	Het
Ankrd17	T	C	5: 90,285,846	H688R	possibly damaging	Het
Atp1a1	C	T	3: 101,590,466	G335D	probably damaging	Het
Cacna1g	C	T	11: 94,459,555	R488H	possibly damaging	Het
Cacna1h	A	T	17: 25,397,620	V149E	probably damaging	Het
Cd22	G	T	7: 30,873,170	P338Q	probably benign	Het
Cntln	G	T	4: 85,096,839	M1122I	probably benign	Het
Cntrl	A	G	2: 35,122,756	N302S	probably benign	Het
Cog8	T	C	8: 107,052,896	R250G	probably damaging	Het
Creld2	T	C	15: 88,823,753	C232R	probably damaging	Het
Cyp2b23	G	A	7: 26,673,149	P347L	probably damaging	Het
Dnah5	T	C	15: 28,403,542		probably null	Het
Eml6	C	T	11: 30,024,459	V40I	probably damaging	Het
Epb42	C	T	2: 121,029,967		probably null	Het
Fcrla	A	G	1: 170,921,004	L190P	probably damaging	Het
Galnt18	A	T	7: 111,779,428	Y40*	probably null	Het
Gdf7	A	T	12: 8,298,073	M416K	probably damaging	Het
Gm11232	T	A	4: 71,756,919		probably null	Het
Gpam	T	A	19: 55,088,176	N198Y	probably damaging	Het
Grip1	C	T	10: 119,986,350	S327F	possibly damaging	Het
Hey2	C	T	10: 30,834,356	A134T	probably benign	Het
Kat6a	T	C	8: 22,938,652	I1341T	probably benign	Het
Kcnd3	T	C	3: 105,668,186	L542P	probably benign	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lman2	T	C	13: 55,351,251	D234G	probably benign	Het
Map3k19	A	C	1: 127,817,898	I1273R	probably damaging	Het
Matn1	T	A	4: 130,950,019	F180I	possibly damaging	Het
Meikin	T	A	11: 54,370,941	L61*	probably null	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Myh13	T	C	11: 67,331,046	I199T	probably damaging	Het
Myh4	T	A	11: 67,248,461	S535T	probably damaging	Het
Myo5a	T	C	9: 75,213,065	M1715T	probably damaging	Het
Nat8	A	T	6: 85,830,989	V54D	probably damaging	Het
Nbea	A	G	3: 56,085,327	V286A	probably damaging	Het
Ndnf	A	G	6: 65,704,014	K426E	possibly damaging	Het
Nup210l	T	A	3: 90,190,972	N1410K	possibly damaging	Het
Oca2	A	T	7: 56,321,521	T399S	probably damaging	Het
Olfr1045	A	G	2: 86,198,252	S167P	probably damaging	Het
Olfr118	A	T	17: 37,672,925	K301*	probably null	Het
Olfr250	G	A	9: 38,368,196	V217I	probably benign	Het
Olfr366	A	C	2: 37,219,659	T57P	possibly damaging	Het
Olfr644	A	T	7: 104,068,459	C191S	probably damaging	Het
Olfr652	T	A	7: 104,565,071	N283K	probably damaging	Het
Otogl	A	C	10: 107,878,152		probably null	Het
Pde4b	C	T	4: 102,605,176	T511I	probably damaging	Het
Proser3	A	G	7: 30,539,747		probably null	Het
Psmd12	G	A	11: 107,479,646	V24M	probably damaging	Het
Rbm17	A	T	2: 11,593,461	M170K	probably benign	Het
Rims2	C	T	15: 39,511,314	T1064I	possibly damaging	Het
Ripor3	C	T	2: 167,992,653	V281M	probably damaging	Het
Rreb1	C	A	13: 37,946,928	Q1353K	possibly damaging	Het
Sgo2a	A	G	1: 58,015,806	D383G	probably benign	Het
Sik3	C	T	9: 46,221,148	T1346M	probably damaging	Het
Slx1b	A	T	7: 126,692,796	V63E	probably damaging	Het
Son	A	G	16: 91,657,086	D907G	probably damaging	Het
Src	G	A	2: 157,469,212	V401M	probably damaging	Het
St3gal4	T	C	9: 35,054,757	K24E	possibly damaging	Het
Stat6	A	G	10: 127,658,245	K647R	probably damaging	Het
Tbl1xr1	G	A	3: 22,193,169		probably null	Het
Tlk2	G	A	11: 105,256,952		probably null	Het
Tmbim6	T	A	15: 99,401,615	I3K	probably benign	Het
Tmeff2	A	T	1: 51,181,867	I334F	probably damaging	Het
Ttn	T	C	2: 76,840,315		probably null	Het
Ubl7	T	A	9: 57,914,611	I81N	probably damaging	Het
Ugt1a10	A	G	1: 88,055,711	Y77C	probably damaging	Het
Uqcrfs1	A	G	13: 30,540,907	C217R	probably damaging	Het
Usp50	T	C	2: 126,761,634	T331A	probably benign	Het
Vmn1r65	A	G	7: 6,009,157	V26A	probably benign	Het
Wdfy3	A	C	5: 101,917,579	V1241G	possibly damaging	Het
Wtap	A	C	17: 12,981,744		probably null	Het
Zbtb40	C	A	4: 136,984,837	A1187S	possibly damaging	Het
Zfp57	T	C	17: 37,006,098	S20P	probably damaging	Het
Zfp592	A	G	7: 81,024,479	D397G	probably damaging	Het
Zfp747	A	T	7: 127,374,504	S165T	probably benign	Het
Zfp949	C	T	9: 88,569,838	T487I	probably damaging	Het
Zscan4d	A	G	7: 11,164,994	C119R	probably damaging	Het

Other mutations in Arhgap24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Arhgap24	APN	5	102860399	missense	possibly damaging	0.94
IGL01483:Arhgap24	APN	5	102860377	missense	possibly damaging	0.91
IGL02641:Arhgap24	APN	5	102892520	missense	probably damaging	1.00
IGL03166:Arhgap24	APN	5	102875686	splice site	probably benign
bullmarket	UTSW	5	102875777	missense	probably damaging	0.99
buyers	UTSW	5	102897220	missense	probably damaging	1.00
wallstreet	UTSW	5	102552297	splice site	probably null
BB009:Arhgap24	UTSW	5	102845969	intron	probably benign
BB019:Arhgap24	UTSW	5	102845969	intron	probably benign
R0506:Arhgap24	UTSW	5	102875777	missense	probably damaging	0.99
R0606:Arhgap24	UTSW	5	102897220	missense	probably damaging	1.00
R1491:Arhgap24	UTSW	5	102860332	missense	possibly damaging	0.47
R1707:Arhgap24	UTSW	5	102892087	missense	probably benign	0.40
R2112:Arhgap24	UTSW	5	102892500	missense	probably damaging	1.00
R2300:Arhgap24	UTSW	5	102860425	missense	probably damaging	1.00
R2516:Arhgap24	UTSW	5	102891910	missense	probably benign
R3803:Arhgap24	UTSW	5	102892442	missense	probably damaging	0.98
R4257:Arhgap24	UTSW	5	102664117	missense	probably benign	0.00
R4761:Arhgap24	UTSW	5	102664214	intron	probably benign
R5045:Arhgap24	UTSW	5	102891877	missense	possibly damaging	0.79
R5121:Arhgap24	UTSW	5	102841335	missense	probably damaging	1.00
R5209:Arhgap24	UTSW	5	102892149	missense	probably benign	0.12
R5667:Arhgap24	UTSW	5	102846171	critical splice donor site	probably null
R5914:Arhgap24	UTSW	5	102552159	splice site	probably null
R6039:Arhgap24	UTSW	5	102880786	missense	probably damaging	0.98
R6039:Arhgap24	UTSW	5	102880786	missense	probably damaging	0.98
R6158:Arhgap24	UTSW	5	102892912	missense	probably benign	0.12
R6410:Arhgap24	UTSW	5	102892151	missense	probably benign	0.10
R6450:Arhgap24	UTSW	5	102897124	missense	probably benign	0.01
R6520:Arhgap24	UTSW	5	102880793	missense	probably benign	0.00
R6666:Arhgap24	UTSW	5	102552297	splice site	probably null
R7233:Arhgap24	UTSW	5	102878501	missense	probably benign	0.03
R7311:Arhgap24	UTSW	5	102892685	missense	probably damaging	1.00
R7460:Arhgap24	UTSW	5	102892346	missense	probably benign	0.36
R7483:Arhgap24	UTSW	5	102841308	missense	probably benign	0.13
R7515:Arhgap24	UTSW	5	102846016	intron	probably benign
R7667:Arhgap24	UTSW	5	102878457	missense	probably benign
R7932:Arhgap24	UTSW	5	102845969	intron	probably benign
R8227:Arhgap24	UTSW	5	102875781	missense	probably benign	0.02
R8289:Arhgap24	UTSW	5	102880826	missense	possibly damaging	0.88
R8431:Arhgap24	UTSW	5	102892598	missense	possibly damaging	0.49
R8721:Arhgap24	UTSW	5	102875699	missense	possibly damaging	0.46
R8767:Arhgap24	UTSW	5	102891874	missense	probably benign
R8954:Arhgap24	UTSW	5	102892270	missense	probably benign	0.00
R9120:Arhgap24	UTSW	5	102892150	missense	probably benign	0.05
R9306:Arhgap24	UTSW	5	102846142	missense	possibly damaging	0.91
R9687:Arhgap24	UTSW	5	102846156	missense	probably benign
Z1176:Arhgap24	UTSW	5	102875759	missense	probably damaging	0.97
Z1176:Arhgap24	UTSW	5	102880807	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCACTGTGTCTCCCTGTGGTAGAAG -3'
(R):5'- TTGCCTGTGTGGATGATAGCCAAG -3'

Sequencing Primer
(F):5'- GCTCCGTAAATTTGATGGCAC -3'
(R):5'- AGCCAAGTAAATGCTTGCTCTC -3'

Posted On

2014-03-14