Incidental Mutation 'R1457:Zfp592'
ID 158570
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Name zinc finger protein 592
Synonyms A730014M16Rik
MMRRC Submission 039512-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.926) question?
Stock # R1457 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 80643432-80694912 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80674227 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 397 (D397G)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
AlphaFold Q8BHZ4
Predicted Effect probably damaging
Transcript: ENSMUST00000107353
AA Change: D397G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: D397G

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176477
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,888,683 (GRCm39) I1210F probably benign Het
Ankrd17 T C 5: 90,433,705 (GRCm39) H688R possibly damaging Het
Arhgap24 T A 5: 102,811,972 (GRCm39) N66K probably damaging Het
Atp1a1 C T 3: 101,497,782 (GRCm39) G335D probably damaging Het
Cacna1g C T 11: 94,350,381 (GRCm39) R488H possibly damaging Het
Cacna1h A T 17: 25,616,594 (GRCm39) V149E probably damaging Het
Cd22 G T 7: 30,572,595 (GRCm39) P338Q probably benign Het
Cntln G T 4: 85,015,076 (GRCm39) M1122I probably benign Het
Cntrl A G 2: 35,012,768 (GRCm39) N302S probably benign Het
Cog8 T C 8: 107,779,528 (GRCm39) R250G probably damaging Het
Cracdl A T 1: 37,665,093 (GRCm39) Y268* probably null Het
Creld2 T C 15: 88,707,956 (GRCm39) C232R probably damaging Het
Cyp2b23 G A 7: 26,372,574 (GRCm39) P347L probably damaging Het
Dnah5 T C 15: 28,403,688 (GRCm39) probably null Het
Eml6 C T 11: 29,974,459 (GRCm39) V40I probably damaging Het
Epb42 C T 2: 120,860,448 (GRCm39) probably null Het
Fcrla A G 1: 170,748,573 (GRCm39) L190P probably damaging Het
Galnt18 A T 7: 111,378,635 (GRCm39) Y40* probably null Het
Gdf7 A T 12: 8,348,073 (GRCm39) M416K probably damaging Het
Gm11232 T A 4: 71,675,156 (GRCm39) probably null Het
Gpam T A 19: 55,076,608 (GRCm39) N198Y probably damaging Het
Grip1 C T 10: 119,822,255 (GRCm39) S327F possibly damaging Het
Hey2 C T 10: 30,710,352 (GRCm39) A134T probably benign Het
Kat6a T C 8: 23,428,668 (GRCm39) I1341T probably benign Het
Kcnd3 T C 3: 105,575,502 (GRCm39) L542P probably benign Het
Lars1 G A 18: 42,343,115 (GRCm39) R1101C probably damaging Het
Lman2 T C 13: 55,499,064 (GRCm39) D234G probably benign Het
Map3k19 A C 1: 127,745,635 (GRCm39) I1273R probably damaging Het
Matn1 T A 4: 130,677,330 (GRCm39) F180I possibly damaging Het
Meikin T A 11: 54,261,767 (GRCm39) L61* probably null Het
Mroh2b G T 15: 4,955,166 (GRCm39) D720Y probably damaging Het
Myh13 T C 11: 67,221,872 (GRCm39) I199T probably damaging Het
Myh4 T A 11: 67,139,287 (GRCm39) S535T probably damaging Het
Myo5a T C 9: 75,120,347 (GRCm39) M1715T probably damaging Het
Nat8 A T 6: 85,807,971 (GRCm39) V54D probably damaging Het
Nbea A G 3: 55,992,748 (GRCm39) V286A probably damaging Het
Ndnf A G 6: 65,680,998 (GRCm39) K426E possibly damaging Het
Nup210l T A 3: 90,098,279 (GRCm39) N1410K possibly damaging Het
Oca2 A T 7: 55,971,269 (GRCm39) T399S probably damaging Het
Or10al2 A T 17: 37,983,816 (GRCm39) K301* probably null Het
Or1af1 A C 2: 37,109,671 (GRCm39) T57P possibly damaging Het
Or51a43 A T 7: 103,717,666 (GRCm39) C191S probably damaging Het
Or52h7 T A 7: 104,214,278 (GRCm39) N283K probably damaging Het
Or8c10 G A 9: 38,279,492 (GRCm39) V217I probably benign Het
Or8j3 A G 2: 86,028,596 (GRCm39) S167P probably damaging Het
Otogl A C 10: 107,714,013 (GRCm39) probably null Het
Pde4b C T 4: 102,462,373 (GRCm39) T511I probably damaging Het
Proser3 A G 7: 30,239,172 (GRCm39) probably null Het
Psmd12 G A 11: 107,370,472 (GRCm39) V24M probably damaging Het
Rbm17 A T 2: 11,598,272 (GRCm39) M170K probably benign Het
Rims2 C T 15: 39,374,710 (GRCm39) T1064I possibly damaging Het
Ripor3 C T 2: 167,834,573 (GRCm39) V281M probably damaging Het
Rreb1 C A 13: 38,130,904 (GRCm39) Q1353K possibly damaging Het
Sgo2a A G 1: 58,054,965 (GRCm39) D383G probably benign Het
Sik3 C T 9: 46,132,446 (GRCm39) T1346M probably damaging Het
Slx1b A T 7: 126,291,968 (GRCm39) V63E probably damaging Het
Son A G 16: 91,453,974 (GRCm39) D907G probably damaging Het
Src G A 2: 157,311,132 (GRCm39) V401M probably damaging Het
St3gal4 T C 9: 34,966,053 (GRCm39) K24E possibly damaging Het
Stat6 A G 10: 127,494,114 (GRCm39) K647R probably damaging Het
Tbl1xr1 G A 3: 22,247,333 (GRCm39) probably null Het
Tlk2 G A 11: 105,147,778 (GRCm39) probably null Het
Tmbim6 T A 15: 99,299,496 (GRCm39) I3K probably benign Het
Tmeff2 A T 1: 51,221,026 (GRCm39) I334F probably damaging Het
Ttn T C 2: 76,670,659 (GRCm39) probably null Het
Ubl7 T A 9: 57,821,894 (GRCm39) I81N probably damaging Het
Ugt1a10 A G 1: 87,983,433 (GRCm39) Y77C probably damaging Het
Uqcrfs1 A G 13: 30,724,890 (GRCm39) C217R probably damaging Het
Usp50 T C 2: 126,603,554 (GRCm39) T331A probably benign Het
Vmn1r65 A G 7: 6,012,156 (GRCm39) V26A probably benign Het
Wdfy3 A C 5: 102,065,445 (GRCm39) V1241G possibly damaging Het
Wtap A C 17: 13,200,631 (GRCm39) probably null Het
Zbtb40 C A 4: 136,712,148 (GRCm39) A1187S possibly damaging Het
Zfp57 T C 17: 37,316,990 (GRCm39) S20P probably damaging Het
Zfp747 A T 7: 126,973,676 (GRCm39) S165T probably benign Het
Zfp949 C T 9: 88,451,891 (GRCm39) T487I probably damaging Het
Zscan4d A G 7: 10,898,921 (GRCm39) C119R probably damaging Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 80,691,296 (GRCm39) nonsense probably null
IGL01984:Zfp592 APN 7 80,688,392 (GRCm39) missense probably benign 0.00
IGL02079:Zfp592 APN 7 80,688,978 (GRCm39) missense probably benign 0.20
IGL02096:Zfp592 APN 7 80,674,796 (GRCm39) missense probably damaging 1.00
IGL02125:Zfp592 APN 7 80,687,932 (GRCm39) missense probably benign 0.00
IGL02374:Zfp592 APN 7 80,674,731 (GRCm39) missense probably damaging 1.00
IGL02419:Zfp592 APN 7 80,687,993 (GRCm39) missense probably damaging 1.00
IGL02466:Zfp592 APN 7 80,673,746 (GRCm39) missense probably damaging 1.00
IGL02485:Zfp592 APN 7 80,687,718 (GRCm39) splice site probably benign
IGL02500:Zfp592 APN 7 80,691,474 (GRCm39) missense probably benign
IGL02876:Zfp592 APN 7 80,687,875 (GRCm39) missense probably benign 0.01
IGL02940:Zfp592 APN 7 80,674,575 (GRCm39) missense probably damaging 1.00
R0326:Zfp592 UTSW 7 80,674,637 (GRCm39) missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 80,687,819 (GRCm39) missense probably damaging 1.00
R0684:Zfp592 UTSW 7 80,687,623 (GRCm39) missense probably benign 0.00
R0750:Zfp592 UTSW 7 80,674,493 (GRCm39) missense probably benign
R1346:Zfp592 UTSW 7 80,687,812 (GRCm39) missense possibly damaging 0.54
R1650:Zfp592 UTSW 7 80,687,848 (GRCm39) missense probably benign 0.04
R1804:Zfp592 UTSW 7 80,673,443 (GRCm39) missense probably damaging 1.00
R1918:Zfp592 UTSW 7 80,687,168 (GRCm39) nonsense probably null
R2114:Zfp592 UTSW 7 80,674,544 (GRCm39) missense probably damaging 1.00
R2144:Zfp592 UTSW 7 80,687,950 (GRCm39) missense probably benign 0.01
R2164:Zfp592 UTSW 7 80,691,186 (GRCm39) missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 80,691,361 (GRCm39) missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 80,687,159 (GRCm39) nonsense probably null
R3809:Zfp592 UTSW 7 80,674,280 (GRCm39) missense probably benign 0.00
R4574:Zfp592 UTSW 7 80,673,534 (GRCm39) missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 80,691,607 (GRCm39) missense probably damaging 1.00
R5023:Zfp592 UTSW 7 80,674,095 (GRCm39) missense probably damaging 1.00
R5121:Zfp592 UTSW 7 80,673,309 (GRCm39) missense probably damaging 1.00
R5174:Zfp592 UTSW 7 80,688,073 (GRCm39) missense probably damaging 1.00
R5794:Zfp592 UTSW 7 80,674,781 (GRCm39) missense probably benign 0.00
R5946:Zfp592 UTSW 7 80,687,645 (GRCm39) missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 80,673,184 (GRCm39) missense probably benign 0.05
R6657:Zfp592 UTSW 7 80,675,234 (GRCm39) missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R6872:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R7056:Zfp592 UTSW 7 80,673,067 (GRCm39) missense probably damaging 1.00
R7295:Zfp592 UTSW 7 80,674,070 (GRCm39) missense probably damaging 1.00
R7351:Zfp592 UTSW 7 80,691,439 (GRCm39) missense probably benign 0.00
R7475:Zfp592 UTSW 7 80,673,200 (GRCm39) missense probably damaging 0.99
R7509:Zfp592 UTSW 7 80,688,088 (GRCm39) missense probably damaging 0.99
R7552:Zfp592 UTSW 7 80,673,390 (GRCm39) missense probably benign 0.01
R7737:Zfp592 UTSW 7 80,674,941 (GRCm39) missense probably damaging 1.00
R7752:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R7901:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R8100:Zfp592 UTSW 7 80,673,940 (GRCm39) missense probably benign 0.05
R8440:Zfp592 UTSW 7 80,691,271 (GRCm39) missense possibly damaging 0.89
R8710:Zfp592 UTSW 7 80,673,321 (GRCm39) missense probably damaging 1.00
R8766:Zfp592 UTSW 7 80,674,353 (GRCm39) missense probably benign 0.00
R9083:Zfp592 UTSW 7 80,674,644 (GRCm39) missense possibly damaging 0.95
R9141:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9194:Zfp592 UTSW 7 80,674,349 (GRCm39) missense probably benign
R9197:Zfp592 UTSW 7 80,674,067 (GRCm39) missense possibly damaging 0.73
R9246:Zfp592 UTSW 7 80,691,529 (GRCm39) missense probably benign 0.03
R9321:Zfp592 UTSW 7 80,691,226 (GRCm39) missense possibly damaging 0.65
R9426:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9785:Zfp592 UTSW 7 80,673,245 (GRCm39) missense probably damaging 1.00
X0022:Zfp592 UTSW 7 80,687,935 (GRCm39) nonsense probably null
X0028:Zfp592 UTSW 7 80,673,762 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGGTCACACAAAGGATTCCTC -3'
(R):5'- TGCACAGCTTTGGGCAAGAGAC -3'

Sequencing Primer
(F):5'- ACAAAGGATTCCTCAGGGC -3'
(R):5'- GATCCTTTTGGGACCCTGGAC -3'
Posted On 2014-03-14