Incidental Mutation 'R1457:Abca14'
ID158575
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene NameATP-binding cassette, sub-family A (ABC1), member 14
Synonyms1700110B15Rik, 4930539G24Rik
MMRRC Submission 039512-MU
Accession Numbers

Genbank: NM_026458; MGI: 2388708

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1457 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location120203961-120325352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120289460 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1210 (I1210F)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
Predicted Effect probably benign
Transcript: ENSMUST00000084640
AA Change: I1210F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: I1210F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,626,012 Y268* probably null Het
Ankrd17 T C 5: 90,285,846 H688R possibly damaging Het
Arhgap24 T A 5: 102,664,106 N66K probably damaging Het
Atp1a1 C T 3: 101,590,466 G335D probably damaging Het
Cacna1g C T 11: 94,459,555 R488H possibly damaging Het
Cacna1h A T 17: 25,397,620 V149E probably damaging Het
Cd22 G T 7: 30,873,170 P338Q probably benign Het
Cntln G T 4: 85,096,839 M1122I probably benign Het
Cntrl A G 2: 35,122,756 N302S probably benign Het
Cog8 T C 8: 107,052,896 R250G probably damaging Het
Creld2 T C 15: 88,823,753 C232R probably damaging Het
Cyp2b23 G A 7: 26,673,149 P347L probably damaging Het
Dnah5 T C 15: 28,403,542 probably null Het
Eml6 C T 11: 30,024,459 V40I probably damaging Het
Epb42 C T 2: 121,029,967 probably null Het
Fcrla A G 1: 170,921,004 L190P probably damaging Het
Galnt18 A T 7: 111,779,428 Y40* probably null Het
Gdf7 A T 12: 8,298,073 M416K probably damaging Het
Gm11232 T A 4: 71,756,919 probably null Het
Gpam T A 19: 55,088,176 N198Y probably damaging Het
Grip1 C T 10: 119,986,350 S327F possibly damaging Het
Hey2 C T 10: 30,834,356 A134T probably benign Het
Kat6a T C 8: 22,938,652 I1341T probably benign Het
Kcnd3 T C 3: 105,668,186 L542P probably benign Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lman2 T C 13: 55,351,251 D234G probably benign Het
Map3k19 A C 1: 127,817,898 I1273R probably damaging Het
Matn1 T A 4: 130,950,019 F180I possibly damaging Het
Meikin T A 11: 54,370,941 L61* probably null Het
Mroh2b G T 15: 4,925,684 D720Y probably damaging Het
Myh13 T C 11: 67,331,046 I199T probably damaging Het
Myh4 T A 11: 67,248,461 S535T probably damaging Het
Myo5a T C 9: 75,213,065 M1715T probably damaging Het
Nat8 A T 6: 85,830,989 V54D probably damaging Het
Nbea A G 3: 56,085,327 V286A probably damaging Het
Ndnf A G 6: 65,704,014 K426E possibly damaging Het
Nup210l T A 3: 90,190,972 N1410K possibly damaging Het
Oca2 A T 7: 56,321,521 T399S probably damaging Het
Olfr1045 A G 2: 86,198,252 S167P probably damaging Het
Olfr118 A T 17: 37,672,925 K301* probably null Het
Olfr250 G A 9: 38,368,196 V217I probably benign Het
Olfr366 A C 2: 37,219,659 T57P possibly damaging Het
Olfr644 A T 7: 104,068,459 C191S probably damaging Het
Olfr652 T A 7: 104,565,071 N283K probably damaging Het
Otogl A C 10: 107,878,152 probably null Het
Pde4b C T 4: 102,605,176 T511I probably damaging Het
Proser3 A G 7: 30,539,747 probably null Het
Psmd12 G A 11: 107,479,646 V24M probably damaging Het
Rbm17 A T 2: 11,593,461 M170K probably benign Het
Rims2 C T 15: 39,511,314 T1064I possibly damaging Het
Ripor3 C T 2: 167,992,653 V281M probably damaging Het
Rreb1 C A 13: 37,946,928 Q1353K possibly damaging Het
Sgo2a A G 1: 58,015,806 D383G probably benign Het
Sik3 C T 9: 46,221,148 T1346M probably damaging Het
Slx1b A T 7: 126,692,796 V63E probably damaging Het
Son A G 16: 91,657,086 D907G probably damaging Het
Src G A 2: 157,469,212 V401M probably damaging Het
St3gal4 T C 9: 35,054,757 K24E possibly damaging Het
Stat6 A G 10: 127,658,245 K647R probably damaging Het
Tbl1xr1 G A 3: 22,193,169 probably null Het
Tlk2 G A 11: 105,256,952 probably null Het
Tmbim6 T A 15: 99,401,615 I3K probably benign Het
Tmeff2 A T 1: 51,181,867 I334F probably damaging Het
Ttn T C 2: 76,840,315 probably null Het
Ubl7 T A 9: 57,914,611 I81N probably damaging Het
Ugt1a10 A G 1: 88,055,711 Y77C probably damaging Het
Uqcrfs1 A G 13: 30,540,907 C217R probably damaging Het
Usp50 T C 2: 126,761,634 T331A probably benign Het
Vmn1r65 A G 7: 6,009,157 V26A probably benign Het
Wdfy3 A C 5: 101,917,579 V1241G possibly damaging Het
Wtap A C 17: 12,981,744 probably null Het
Zbtb40 C A 4: 136,984,837 A1187S possibly damaging Het
Zfp57 T C 17: 37,006,098 S20P probably damaging Het
Zfp592 A G 7: 81,024,479 D397G probably damaging Het
Zfp747 A T 7: 127,374,504 S165T probably benign Het
Zfp949 C T 9: 88,569,838 T487I probably damaging Het
Zscan4d A G 7: 11,164,994 C119R probably damaging Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 120246853 missense probably damaging 1.00
IGL00800:Abca14 APN 7 120255390 missense probably benign 0.01
IGL00845:Abca14 APN 7 120223951 splice site probably benign
IGL00897:Abca14 APN 7 120216125 splice site probably benign
IGL01524:Abca14 APN 7 120253421 missense possibly damaging 0.57
IGL01747:Abca14 APN 7 120278087 missense probably benign 0.00
IGL02214:Abca14 APN 7 120294175 missense probably benign 0.09
IGL02215:Abca14 APN 7 120253389 missense probably benign 0.00
IGL02253:Abca14 APN 7 120207959 missense probably benign 0.29
IGL02302:Abca14 APN 7 120318745 splice site probably benign
IGL03391:Abca14 APN 7 120246884 missense probably damaging 1.00
F6893:Abca14 UTSW 7 120325038 missense probably damaging 0.98
R0109:Abca14 UTSW 7 120318762 nonsense probably null
R0109:Abca14 UTSW 7 120318762 nonsense probably null
R0265:Abca14 UTSW 7 120223627 missense probably benign 0.03
R0326:Abca14 UTSW 7 120224419 missense probably damaging 1.00
R0380:Abca14 UTSW 7 120278480 missense probably benign 0.03
R0418:Abca14 UTSW 7 120207434 missense probably damaging 1.00
R0539:Abca14 UTSW 7 120207797 missense probably damaging 1.00
R0574:Abca14 UTSW 7 120224497 missense probably damaging 0.96
R0611:Abca14 UTSW 7 120252256 missense possibly damaging 0.63
R0783:Abca14 UTSW 7 120294157 missense probably damaging 1.00
R0785:Abca14 UTSW 7 120294157 missense probably damaging 1.00
R0863:Abca14 UTSW 7 120216230 missense probably benign 0.03
R1034:Abca14 UTSW 7 120216147 missense probably damaging 1.00
R1056:Abca14 UTSW 7 120325072 missense probably damaging 1.00
R1072:Abca14 UTSW 7 120212769 missense probably benign
R1244:Abca14 UTSW 7 120216338 missense probably benign 0.06
R1255:Abca14 UTSW 7 120207793 missense probably damaging 0.97
R1271:Abca14 UTSW 7 120325117 missense probably damaging 1.00
R1325:Abca14 UTSW 7 120247322 missense probably benign 0.32
R1467:Abca14 UTSW 7 120216182 missense possibly damaging 0.80
R1467:Abca14 UTSW 7 120216182 missense possibly damaging 0.80
R1494:Abca14 UTSW 7 120216301 missense probably benign 0.00
R1551:Abca14 UTSW 7 120318878 missense probably benign 0.10
R1607:Abca14 UTSW 7 120251291 missense probably damaging 1.00
R1739:Abca14 UTSW 7 120278306 missense probably benign 0.04
R1856:Abca14 UTSW 7 120278181 missense probably damaging 1.00
R1875:Abca14 UTSW 7 120247967 missense possibly damaging 0.78
R1892:Abca14 UTSW 7 120216338 missense probably benign 0.06
R1898:Abca14 UTSW 7 120251169 missense probably damaging 1.00
R1958:Abca14 UTSW 7 120325159 missense probably damaging 0.98
R2018:Abca14 UTSW 7 120216185 missense probably benign 0.00
R2039:Abca14 UTSW 7 120312264 missense probably damaging 0.98
R2060:Abca14 UTSW 7 120227518 nonsense probably null
R2202:Abca14 UTSW 7 120289541 missense probably benign 0.17
R2205:Abca14 UTSW 7 120247280 missense probably damaging 0.98
R2360:Abca14 UTSW 7 120251208 missense probably benign 0.00
R2401:Abca14 UTSW 7 120283089 missense probably damaging 1.00
R2426:Abca14 UTSW 7 120283223 missense probably benign 0.04
R3433:Abca14 UTSW 7 120294232 missense probably damaging 0.97
R4598:Abca14 UTSW 7 120255403 missense probably benign 0.11
R4599:Abca14 UTSW 7 120255403 missense probably benign 0.11
R4700:Abca14 UTSW 7 120312705 critical splice donor site probably null
R4751:Abca14 UTSW 7 120312177 missense probably benign 0.01
R4826:Abca14 UTSW 7 120216247 missense probably damaging 1.00
R4828:Abca14 UTSW 7 120216247 missense probably damaging 1.00
R4837:Abca14 UTSW 7 120246980 missense probably benign
R4881:Abca14 UTSW 7 120278249 missense possibly damaging 0.49
R4895:Abca14 UTSW 7 120247349 critical splice donor site probably null
R4928:Abca14 UTSW 7 120324580 missense possibly damaging 0.90
R4990:Abca14 UTSW 7 120312165 missense probably benign 0.00
R5027:Abca14 UTSW 7 120312282 missense probably benign 0.05
R5091:Abca14 UTSW 7 120252274 missense probably damaging 1.00
R5158:Abca14 UTSW 7 120253429 missense probably benign
R5209:Abca14 UTSW 7 120232907 missense probably benign 0.01
R5333:Abca14 UTSW 7 120289546 nonsense probably null
R5424:Abca14 UTSW 7 120211554 missense probably benign 0.01
R5488:Abca14 UTSW 7 120252250 missense probably damaging 0.98
R5489:Abca14 UTSW 7 120252250 missense probably damaging 0.98
R5716:Abca14 UTSW 7 120246994 critical splice donor site probably null
R6450:Abca14 UTSW 7 120216226 missense probably benign 0.17
R6477:Abca14 UTSW 7 120325102 missense probably benign 0.44
R6652:Abca14 UTSW 7 120246941 missense probably damaging 1.00
R6782:Abca14 UTSW 7 120248085 missense probably damaging 1.00
R6874:Abca14 UTSW 7 120252205 missense possibly damaging 0.71
R6965:Abca14 UTSW 7 120283229 nonsense probably null
R7142:Abca14 UTSW 7 120251183 missense possibly damaging 0.89
R7146:Abca14 UTSW 7 120255297 missense probably benign 0.15
R7202:Abca14 UTSW 7 120318013 missense probably damaging 1.00
R7220:Abca14 UTSW 7 120227444 missense possibly damaging 0.45
R7241:Abca14 UTSW 7 120246961 missense probably damaging 1.00
R7291:Abca14 UTSW 7 120289609 nonsense probably null
R7296:Abca14 UTSW 7 120278311 missense probably benign
R7298:Abca14 UTSW 7 120207883 missense probably benign 0.00
R7315:Abca14 UTSW 7 120294118 missense probably benign 0.00
R7776:Abca14 UTSW 7 120232991 critical splice donor site probably null
R7820:Abca14 UTSW 7 120212721 missense probably benign 0.42
R7873:Abca14 UTSW 7 120289569 missense probably benign 0.17
R8215:Abca14 UTSW 7 120294202 missense probably benign
R8332:Abca14 UTSW 7 120216213 missense probably benign
Z1088:Abca14 UTSW 7 120216135 missense probably benign 0.14
Z1176:Abca14 UTSW 7 120246923 missense probably damaging 1.00
Z1177:Abca14 UTSW 7 120317987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGTTCATCAAGGGTAGACTAGC -3'
(R):5'- CCCTTCTCACTAGAGGGAGCACATAC -3'

Sequencing Primer
(F):5'- GGTAGACTAGCTAGTGGCAAGAAAT -3'
(R):5'- CCTCTGATGGATCTTGGAGAACC -3'
Posted On2014-03-14